Rbm8a (NM_001271138) Rat Untagged Clone

CAT#: RN215957

Rbm8a (untagged) - Rat RNA binding motif protein 8A (Rbm8a)



  "NM_001271138" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-Rbm8a Antibody
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Rbm8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215957 representing NM_001271138
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGACGTGCTGGATCTTCACGAGGCCGGGGGCGAGGATTTCGCCATGGATGAGGATGGTGACGAAA
GCATCCACAAACTAAAAGAAAAAGCGAAGAAACGGAAGGGCCGCGGTTTTGGTTCTGAAGAGGGGTCCCG
AGCGCGGATGCGGGAAGATTATGACAGTGTGGAGCAGGATGGCGATGAACCTGGACCACAGCGCTCTGTT
GAAGGTTGGATTCTCTTTGTCACTGGAGTCCACGAAGAAGCCACTGAAGAAGATATCCATGACAAGTTCG
CTGAATATGGGGAAATAAAAAATATCCACCTGAATTTGGACAGGCGCACGGGATACTTGAAGGGGTATAC
TCTAGTTGAGTATGAAACATACAAAGAAGCTCAGGCTGCCATGGAGGGACTAAATGGTCAAGATTTGATG
GGACAGCCAATCAGTGTTGACTGGTGTTTTGTTCGTGGTCCACCAAAGGGCAAGAGGAGAGGTGGCCGAA
GACGAAGCAGGAGTCCAGACCGAAGACGCCGATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001271138
Insert Size 525 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271138.1, NP_001258067.1
RefSeq Size 1486 bp
RefSeq ORF 525 bp
Locus ID 295284
UniProt ID Q27W01
Gene Summary Required for pre-mRNA splicing as component of the spliceosome (By similarity). Core component of the splicing-dependent multiprotein exon junction complex (EJC) deposited at splice junctions on mRNAs. The EJC is a dynamic structure consisting of core proteins and several peripheral nuclear and cytoplasmic associated factors that join the complex only transiently either during EJC assembly or during subsequent mRNA metabolism. The EJC marks the position of the exon-exon junction in the mature mRNA for the gene expression machinery and the core components remain bound to spliced mRNAs throughout all stages of mRNA metabolism thereby influencing downstream processes including nuclear mRNA export, subcellular mRNA localization, translation efficiency and nonsense-mediated mRNA decay (NMD). Its removal from cytoplasmic mRNAs requires translation initiation from EJC-bearing spliced mRNAs. Associates preferentially with mRNAs produced by splicing. Does not interact with pre-mRNAs, introns, or mRNAs produced from intronless cDNAs. Associates with both nuclear mRNAs and newly exported cytoplasmic mRNAs (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...