Crem (NM_001271248) Rat Untagged Clone

CAT#: RN215789

Crem (untagged) - Rat cAMP responsive element modulator (Crem), transcript variant 9



  "NM_001271248" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Icer
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215789 representing NM_001271248
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCAACTTACCAGATCCGAGCTCCTACTACTGCTTTGCCACAAGGTGTGGTGATGGCTGCCTCACCAG
GGAGTCTGCACAGTCCCCAGCAACTAGCAGAAGAAGCAACTCGAAAGCGGGAGCTGAGGCTGATGAAAAA
CAGGGAAGCTGCTAAAGAATGTCGACGTCGAAAGAAAGAGTATGTGAAGTGTCTGGAGAGCCGAGTCGCA
GTGCTGGAAGTTCAGAACAAGAAGCTTATAGAGGAGCTTGAAACCTTGAAAGACATTTGCTCTCCCAAAA
CAGATTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001271248
Insert Size 288 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271248.1, NP_001258177.1
RefSeq Size 3072 bp
RefSeq ORF 288 bp
Locus ID 25620
Gene Summary Transcriptional regulator that binds the cAMP response element (CRE), a sequence present in many viral and cellular promoters. Isoforms are either transcriptional activators or repressors. Isoform Delta is an activator. Plays a role in spermatogenesis and is involved in spermatid maturation. Binding of isoform Tau (activator) to CRE is increased by CREB3L4. The CREM isoform Tau-CREB3L4 heterodimer functions through CRE and may recruit HIRA to CRE to regulate histone exchange (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (9) differs in both UTR's and the coding region but maintains the reading frame, compared to variant 3. This results in a protein (isoform 9) that is shorter at both the N- and C-termini, compared to isoform 3. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...