Gskip (NM_001014198) Rat Untagged Clone
CAT#: RN214645
Gskip (untagged ORF) - Rat similar to RIKEN cDNA 4933433P14 gene (RGD1308470), (10 ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | RGD1308470 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN214645 representing NM_001014198
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGAGCTCGCAGAATGGAAACAGACTGTAATCCCGTGGATCTAAGCAGTATGTCTGGATTCGAAGAAG GCTCCGAGCTCAACGGGTTTGAAGGAACAGATATGAAGGACATGCAGCTGGAGGCTGAGGCCGTTGTCAA TGACGTTCTCTTTGCTGTCAACAACATGTTTGTCTCAAAAAGCCTGCCCTGTGCAGACGATGTGGCTTAC ATCAATGTGGAGACAAAGGAAAGAAACAGATACTGCCTGGAGCTCACAGAAGCAGGGCTCAGGGTGGTGG GCTATGCTTTTGACCAGGTGGAGGACCATTTGCAAACCCCCTACCATGAGACAGTCTACTCCCTGTTGGA TACGCTCAGCCCTGCCTACCGGGAAGCATTTGGAAATGCTCTCCTTCAGAGACTGGAAGCTTTGAAACGA GATGGACAGTCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001014198 |
Insert Size | 435 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001014198.2, NP_001014220.2 |
RefSeq Size | 1629 bp |
RefSeq ORF | 435 bp |
Locus ID | 362778 |
UniProt ID | Q5PPI3 |
Gene Summary | A-kinase anchoring protein for GSK3B and PKA that regulates or facilitates their kinase activity towards their targets. The ternary complex enhances Wnt-induced signaling by facilitating the GSK3B- and PKA-induced phosphorylation of beta-catenin leading to beta-catenin degradation and stabilization respectively. Upon cAMP activation, the ternary complex contributes to neuroprotection against oxidative stress-induced apoptosis by facilitating the PKA-induced phosphorylation of DML1 and PKA-induced inactivation of GSK3B. During neurite outgrowth promotes neuron proliferation; while increases beta-catenin-induced transcriptional activity through GSK3B kinase activity inhibition, reduces N-cadherin level to promote cell cycle progression (By similarity). May play a role in cleft palate formation and is required for postnatal life through modulation of the activity of GSK3B during development (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR214645 | Gskip (Myc-DDK-tagged ORF) - Rat similar to RIKEN cDNA 4933433P14 gene (RGD1308470), (10 ug) |
CNY 3,990.00 |
|
RR214645L3 | Lenti ORF clone of Gskip (Myc-DDK-tagged ORF) - Rat similar to RIKEN cDNA 4933433P14 gene (RGD1308470), (10 ug) |
CNY 6,080.00 |
|
RR214645L4 | Lenti ORF clone of Gskip (mGFP-tagged ORF) - Rat similar to RIKEN cDNA 4933433P14 gene (RGD1308470), (10 ug) |
CNY 6,650.00 |