United States
Germany
Japan
United Kingdom
China
Pttg1 (NM_022391) Rat Untagged Clone
CAT＃: RN214617
Pttg1 (untagged ORF) - Rat pituitary tumor-transforming 1 (Pttg1), (10 ug)
CNY 3,990.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Rat Untagged Clone |
| Tag | Tag Free |
| Synonyms | Pttg |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>RN214617 representing NM_022391
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTACTCTGATCTTTGTTGATAAGGATAACGAAGAGCCAGGCAGCCGTTTGGCATCTAAGGATGGAT TGAAGCTGGGCTCTGGTGTCAAAGCCTTAGATGGGAAATTGCAGGTTTCAACGCCACGAGTCGGCAAAGT GTTCGGTGCCCCAGGCTTGCCTAAAGCCAGCAGGAAGGCTCTGGGAACTGTCAACAGAGTTACTGAAAAG CCAGTGAAGAGTAGTAAACCCCTGCAATCGAAACAGCCGACTCTGAGTGTGAAAAAGATCACCGAGAAGT CTACTAAGACACAAGGCTCTGCTCCTGCTCCTGATGATGCCTACCCAGAAATAGAAAAGTTCTTCCCCTT CGATCCTCTAGATTTTGAGAGTTTTGACCTGCCTGAAGAGCACCAGATCTCACTTCTCCCCTTGAATGGA GTGCCTCTCATGATCCTGAATGAAGAGAGGGGGCTTGAGAAGCTGCTGCACCTGGACCCCCCTTCCCCTC TGCAGAAGCCCTTCCTACCGTGGGAATCTGATCCGTTGCCGTCTCCTCCCAGCGCCCTCTCCGCTCTGGA TGTTGAATTGCCGCCTGTTTGTTACGATGCAGATATTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_022391 |
| Insert Size | 600 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_022391.2, NP_071786.1 |
| RefSeq Size | 959 bp |
| RefSeq ORF | 600 bp |
| Locus ID | 64193 |
| UniProt ID | P97613 |
| Gene Summary | Regulatory protein, which plays a central role in chromosome stability, in the p53/TP53 pathway, and DNA repair. Probably acts by blocking the action of key proteins. During the mitosis, it blocks Separase/ESPL1 function, preventing the proteolysis of the cohesin complex and the subsequent segregation of the chromosomes. At the onset of anaphase, it is ubiquitinated, conducting to its destruction and to the liberation of ESPL1. Its function is however not limited to a blocking activity, since it is required to activate ESPL1. Negatively regulates the transcriptional activity and related apoptosis activity of p53/TP53. The negative regulation of p53/TP53 may explain the strong transforming capability of the protein when it is overexpressed. May also play a role in DNA repair via its interaction with Ku, possibly by connecting DNA damage-response pathways with sister chromatid separation (By similarity).[UniProtKB/Swiss-Prot Function] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Pituitary tumor-transforming gene 1 regulates invasion of prostate cancer cells through MMP13.
,null,
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine
,PubMed ID 26201898
[Pttg1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RR214617 | Pttg1 (Myc-DDK-tagged ORF) - Rat pituitary tumor-transforming 1 (Pttg1), (10 ug) |
CNY 2,400.00 |
|
| RR214617L3 | Lenti ORF clone of Pttg1 (Myc-DDK-tagged ORF) - Rat pituitary tumor-transforming 1 (Pttg1), (10 ug) |
CNY 6,080.00 |
|
| RR214617L4 | Lenti ORF clone of Pttg1 (mGFP-tagged ORF) - Rat pituitary tumor-transforming 1 (Pttg1), (10 ug) |
CNY 6,650.00 |
