Hnrnpa2b1 (NM_001104613) Rat Untagged Clone

CAT#: RN213922

Hnrnpa2b1 (untagged ORF) - Rat heterogeneous nuclear ribonucleoprotein A2/B1 (Hnrnpa2b1), (10 ug)



  "NM_001104613" in other vectors (3)

CNY 3,990.00


货期*
6周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms hnRNP; Hnrpa2; Hnrpa2b1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN213922 representing NM_001104613
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGAAAACTTTAGAAACTGTTCCTTTGGAGAGGAAAAAGAGAGAGAAGGAACAGTTCCGTAAGCTCT
TTATTGGTGGCTTAAGCTTTGAAACCACAGAAGAAAGTTTGAGAAACTACTACGAGCAATGGGGAAAGCT
CACAGACTGTGTGGTTATGCGGGATCCTGCAAGCAAAAGATCAAGAGGATTTGGCTTTGTAACTTTCTCA
TCTATGGCTGAGGTTGATGCTGCCATGGCTGCAAGGCCTCATTCCATTGATGGCAGGGTGGTTGAGCCAA
AACGTGCTGTGGCAAGAGAGGAGTCTGGGAAACCAGGAGCCCATGTGACTGTGAAGAAACTGTTCGTTGG
TGGAATTAAGGAAGATACTGAGGAGCATCACCTTAGAGATTACTTTGAAGAATATGGAAAAATTGATACT
ATTGAAATAATTACTGATAGGCAGTCTGGAAAAAAAAGAGGCTTTGGCTTTGTTACCTTTGATGACCATG
ATCCTGTGGATAAGATTTTCTTGCAGAAATATCACACCATAAATGGTCACAATGCAGAAGTTAGAAAGGC
ATTGTCTAGACAAGAAATGCAGGAAGTCCAAAGTTCTAGGAGTGGAAGAGGAGGAAACTTTGGTTTTGGA
GATTCTCGAGGTGGCGGTGGCAATTTTGGACCAGGACCAGGAAGCAACTTTAGGGGGGGTTCTGATGGAT
ATGGAAGTGGACGTGGATTTGGGGATGGCTATAATGGGTATGGAGGAGGACCTGGAGGTGGCAATTTTGG
AGGTAGCCCTGGTTATGGAGGAGGAAGAGGAGGATATGGTGGTGGAGGACCTGGATATGGCAACCAGGGT
GGGGGCTACGGAGGTGGTTATGACAACTATGGAGGAGGAAATTATGGAAGTGGAAATTACAATGATTTTG
GAAATTATAACCAGCAACCTTCTAACTACGGTCCAATGAAGAGTGGAAACTTTGGTGGTAGCAGGAACAT
GGGAGGACCATATGGTGGAGGGAACTATGGTCCTGGAGGAAGTGGAGGAAGTGGGGGCTATGGTGGGAGG
AGCCGATACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001104613
Insert Size 1062 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001104613.1, NP_001098083.1
RefSeq Size 1062 bp
RefSeq ORF 1062 bp
Locus ID 362361
UniProt ID A7VJC2
Gene Summary Heterogeneous nuclear ribonucleoprotein (hnRNP) that associates with nascent pre-mRNAs, packaging them into hnRNP particles. The hnRNP particle arrangement on nascent hnRNA is non-random and sequence-dependent and serves to condense and stabilize the transcripts and minimize tangling and knotting. Packaging plays a role in various processes such as transcription, pre-mRNA processing, RNA nuclear export, subcellular location, mRNA translation and stability of mature mRNAs. Forms hnRNP particles with at least 20 other different hnRNP and heterogeneous nuclear RNA in the nucleus (PubMed:19099192). Involved in transport of specific mRNAs to the cytoplasm in oligodendrocytes and neurons: acts by specifically recognizing and binding the A2RE (21 nucleotide hnRNP A2 response element) or the A2RE11 (derivative 11 nucleotide oligonucleotide) sequence motifs present on some mRNAs, and promotes their transport to the cytoplasm (PubMed:9578590, PubMed:10567417). Specifically binds single-stranded telomeric DNA sequences, protecting telomeric DNA repeat against endonuclease digestion (PubMed:15659580). Also binds other RNA molecules, such as primary miRNA (pri-miRNAs): acts as a nuclear 'reader' of the N6-methyladenosine (m6A) mark by specifically recognizing and binding a subset of nuclear m6A-containing pri-miRNAs. Binding to m6A-containing pri-miRNAs promotes pri-miRNA processing by enhancing binding of DGCR8 to pri-miRNA transcripts. Involved in miRNA sorting into exosomes following sumoylation, possibly by binding (m6A)-containing pre-miRNAs. Acts as a regulator of efficiency of mRNA splicing, possibly by binding to m6A-containing pre-mRNAs (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...