Cox8c (NM_183055) Rat Untagged Clone
CAT#: RN213568
Cox8c (untagged ORF) - Rat cytochrome c oxidase, subunit 8C (Cox8c), nuclear gene encoding mitochondrial protein, (10 ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | COXVIII-3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN213568 representing NM_183055
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCTCGCTTGCTGCAGTTCTGCTCTTCCCTCCTCCGACACCGTGTAGTCCTGTTCTCGAAGCCTGGCC ACTCAGGCCGCCTCAGCCACTCAGAAAGCCCACAAAACCAAGTCCTGACACCCACGGAATCGGTTGTTGG AATTGTCGTGTTTTTTGCCACCTTTTTCATCCCAGCTGCGTATGTGATGAGCAACCTGAAGTTTTTCAAA GGCGAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_183055 |
Insert Size | 219 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_183055.1, NP_898878.1 |
RefSeq Size | 548 bp |
RefSeq ORF | 219 bp |
Locus ID | 360229 |
UniProt ID | Q7TNN2 |
Gene Summary | This protein is one of the nuclear-coded polypeptide chains of cytochrome c oxidase, the terminal oxidase in mitochondrial electron transport.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR213568 | Cox8c (Myc-DDK-tagged ORF) - Rat cytochrome c oxidase, subunit 8C (Cox8c), nuclear gene encoding mitochondrial protein, (10 ug) |
CNY 3,990.00 |
|
RR213568L3 | Lenti ORF clone of Cox8c (Myc-DDK-tagged ORF) - Rat cytochrome c oxidase, subunit 8C (Cox8c), nuclear gene encoding mitochondrial protein, (10 ug) |
CNY 6,080.00 |
|
RR213568L4 | Lenti ORF clone of Cox8c (mGFP-tagged ORF) - Rat cytochrome c oxidase, subunit 8C (Cox8c), nuclear gene encoding mitochondrial protein, (10 ug) |
CNY 6,650.00 |