Polr2e (NM_001109614) Rat Untagged Clone

CAT#: RN213420

Polr2e (untagged ORF) - Rat polymerase (RNA) II (DNA directed) polypeptide E, 25kDa (Polr2e), (10 ug)



  "NM_001109614" in other vectors (3)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN213420 representing NM_001109614
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACGACGAGGAGGAAACGTATCGGCTGTGGAAGATCCGCAAGACTATCATGCAGCTGTGTCATGACC
GAGGCTACCTGGTGACCCAGGATGAGCTGGACCAGACACTTGAAGAGTTCAAGGCACAGTTTGGGGACAA
GCCCAGCGAAGGACGGCCGAGGCGCACAGACCTCACCGTGCTGGTGGCCCACAACGATGATCCCACAGAC
CAGATGTTTGTCTTCTTCCCAGAGGAGCCCAAGGTGGGCATCAAGACCATCAAGGTGTACTGCCAGCGCA
TGCAGGAGGAGAACATCACACGGGCGCTGATCGTGGTGCAGCAGGGCATGACACCCTCCGCCAAGCAGTC
CCTGGTAGACATGGCCCCTAAGTACGTGCTAGAACAGTTTCTACAGCAGGAGCTGCTCATCAATATCACA
GAACATGAGCTAGTCCCTGAGCACGTGGTCATGACCAAGGAGGAGGTGACGGAACTGCTGGCGCGATACA
AGCTCCGTGAGAGCCAGCTGCCCAGGATCCAGGCTGGGGACCCGGTGGCACGGTACTTCGGGATCAAGCG
AGGGCAGGTTGTGAAGATTATCCGCCCCAGTGAGACAGCCGGCCGGTACATCACCTACCGCCTGGTGCAG
TAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001109614
Insert Size 633 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001109614.1, NP_001103084.1
RefSeq Size 1082 bp
RefSeq ORF 633 bp
Locus ID 690966
UniProt ID B0BNE2
Gene Summary DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Common component of RNA polymerases I, II and III which synthesize ribosomal RNA precursors, mRNA precursors and many functional non-coding RNAs, and small RNAs, such as 5S rRNA and tRNAs, respectively. Pol II is the central component of the basal RNA polymerase II transcription machinery. Pols are composed of mobile elements that move relative to each other. In Pol II, POLR2E/RPB5 is part of the lower jaw surrounding the central large cleft and thought to grab the incoming DNA template. Seems to be the major component in this process (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...