United States
Germany
Japan
United Kingdom
China
Snap25 (NM_030991) Rat Untagged Clone
CAT＃: RN212183
Snap25 (untagged ORF) - Rat synaptosomal-associated protein 25 (Snap25), (10 ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Rat Untagged Clone |
| Tag | Tag Free |
| Synonyms | SNAP-25a; SNAP-25B |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>RN212183 representing NM_030991
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCGAGGACGCAGACATGCGTAATGAACTGGAGGAGATGCAGAGGAGGGCTGACCAGCTGGCTGATG AGTCCCTGGAAAGCACCCGTCGCATGCTGCAGCTGGTCGAAGAGAGTAAAGATGCTGGCATCAGGACTTT GGTTATGTTGGATGAGCAAGGCGAACAACTGGAACGCATTGAGGAAGGGATGGACCAAATCAATAAGGAT ATGAAAGAAGCAGAAAAGAATTTGACGGACCTAGGAAAATTCTGCGGGCTTTGTGTGTGTCCCTGTAACA AGCTTAAATCCAGTGATGCTTACAAAAAAGCCTGGGGCAATAATCAGGATGGAGTAGTGGCCAGCCAGCC TGCCCGTGTGGTGGATGAACGGGAGCAGATGGCCATCAGTGGTGGCTTCATCCGCAGGGTAACAAACGAT GCCCGGGAAAATGAAATGGATGAAAACCTAGAGCAGGTGAGCGGCATCATCGGAAACCTCCGTCATATGG CCCTAGACATGGGCAATGAGATTGACACCCAGAATCGCCAGATTGACAGGATCATGGAGAAGGCTGACTC CAACAAAACCAGAATTGATGAAGCCAACCAACGTGCAACAAAGATGCTGGGAAGTGGTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_030991 |
| Insert Size | 621 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_030991.3, NP_112253.1 |
| RefSeq Size | 2135 bp |
| RefSeq ORF | 621 bp |
| Locus ID | 25012 |
| UniProt ID | P60881 |
| Gene Summary | Synaptic vesicle membrane docking and fusion is mediated by SNAREs (soluble N-ethylmaleimide-sensitive factor attachment protein receptors) located on the vesicle membrane (v-SNAREs) and the target membrane (t-SNAREs). The assembled v-SNARE/t-SNARE complex consists of a bundle of four helices, one of which is supplied by v-SNARE and the other three by t-SNARE. For t-SNAREs on the plasma membrane, the protein syntaxin supplies one helix and the protein encoded by this gene contributes the other two. Therefore, this gene product is a presynaptic plasma membrane protein. It is essential for regulated exocytosis in neuronal cells. Alternative transcript variants encoding two different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (3, also known as b) has an alternate in-frame exon in the coding region, compared to variant 1. The resulting isoform (b) is of the same length, but has a distinct internal segment, compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RR212183 | Snap25 (Myc-DDK-tagged ORF) - Rat synaptosomal-associated protein 25 (Snap25), (10 ug) |
CNY 3,840.00 |
|
| RR212183L3 | Lenti ORF clone of Snap25 (Myc-DDK-tagged ORF) - Rat synaptosomal-associated protein 25 (Snap25), (10 ug) |
CNY 6,080.00 |
|
| RR212183L4 | Lenti ORF clone of Snap25 (mGFP-tagged ORF) - Rat synaptosomal-associated protein 25 (Snap25), (10 ug) |
CNY 6,650.00 |
