Ube2s (NM_001106224) Rat Untagged Clone

CAT#: RN211808

Ube2s (untagged ORF) - Rat ubiquitin-conjugating enzyme E2S (Ube2s), (10 ug)



  "NM_001106224" in other vectors (3)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms RGD1564746
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN211808 representing NM_001106224
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACTCCAATGTAGAGAATCTCCCTCCCCACATCATCCGCCTAGTGTACAAGGAGGTGACAACACTGA
CAGCAGATCCACCCGATGGCATTAAAGTCTTCCCCAATGAGGAGGATCTCACCGACCTGCAGGTTACAAT
CGAGGGCCCTGAAGGGACCCCCTATGCTGGAGGTCTGTTCCGTATGAAGCTCCTACTAGGGAAGGACTTC
CCTGCCTCCCCACCCAAGGGCTACTTCCTGACTAAAATCTTCCACCCAAATGTGGGCCCCAATGGTGAGA
TCTGTGTCAACGTGCTCAAGAGGGACTGGACTGCTGAGTTGGGCATACGACATGTGCTGCTGACCATCAA
GTGCCTGCTGATCCATCCTAACCCAGAGTCTGCACTCAATGAGGAGGCAGGCCGCCTGCTTTTGGAGAAC
TACGAGGAGTATGCTGCCCGGGCCCGTCTGCTCACAGAGATCCATGGGGGTGCATGTAGCACCAGCAGTG
GGAGGGCTGAGGCTTCCCGGGACCTGGCCAGTGGGGCTTCAGCCTCCTCCACTGACCCTATGACCCCAGG
GGTCCTAGGAGGAGCTGAGGGTCCCATGGCCAAGAAACATGCAGGTGAGCGAGATAAGAAGCTGGCAGCC
AAGAAAAAGTTGGACAAGAAGCGAGCACTGAGGCGACTGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001106224
Insert Size 672 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001106224.2, NP_001099694.1
RefSeq Size 991 bp
RefSeq ORF 672 bp
Locus ID 292588
UniProt ID B5DFI8
Gene Summary Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. Catalyzes 'Lys-11'-linked polyubiquitination. Acts as an essential factor of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated ubiquitin ligase that controls progression through mitosis. Acts by specifically elongating 'Lys-11'-linked polyubiquitin chains initiated by the E2 enzyme UBE2C/UBCH10 on APC/C substrates, enhancing the degradation of APC/C substrates by the proteasome and promoting mitotic exit. Also acts by elongating ubiquitin chains initiated by the E2 enzyme UBE2D1/UBCH5 in vitro; it is however unclear whether UBE2D1/UBCH5 acts as an E2 enzyme for the APC/C in vivo. Also involved in ubiquitination and subsequent degradation of VHL, resulting in an accumulation of HIF1A. In vitro able to promote polyubiquitination using all 7 ubiquitin Lys residues, except 'Lys-48'-linked polyubiquitination.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...