Artn (NM_053397) Rat Untagged Clone
CAT#: RN209126
Artn (untagged ORF) - Rat artemin (Artn), (10 ug)
CNY 3,990.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN209126 representing NM_053397
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAACTGGGACTTGGAGAGCCTACTGCATTGTCCCACTGCCTCCGGCCTAGGTGGCAACCAGCCTTGT GGCCAACCCTAGCTGCTCTAGCCCTGCTGAGCAGCGTCACAGAAGCTTCCCTGGACCCAATGTCCCGCAG CCCCGCCTCTCGCGATGTTCCCTCGCCGGTCCTGGCGCCCCCAACAGACTACCTACCTGGGGGACACACC GCACATCTGTGCAGCGAAAGAGCCCTGCGACCACCGCCGCAGTCTCCTCAGCCCGCACCCCCACCACCCG GTCCCGCGCTCCAGTCTCCTCCCGCTGCGCTCCGCGGGGCACGCGCGGCGCGTGCAGGAACCCGGAGCAG CCGCGCACGGGCTACAGATGCGCGCGGCTGCCGCCTGCGCTCACAGCTGGTGCCGGTGAGCGCTCTCGGC CTGGGCCACAGCTCCGACGAGCTGATACGTTTCCGCTTCTGCAGCGGTTCGTGCCGCCGAGCACGCTCCC CGCACGATCTCAGCCTGGCCAGCCTGCTGGACGCCGGGGCCCTGCGGTCGCCTCCCGGGTCCCGGCCGAT CAGCCAGCCCTGTTGCCGGCCCACTCGCTATGAGGCCGTCTCCTTCATGGACGTGAACAGCACCTGGAGA ACCGTGGACCATCTCTCCGCCACCGCCTGCGGCTGTCTGGGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_053397 |
Insert Size | 675 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_053397.1, NP_445849.1 |
RefSeq Size | 1357 bp |
RefSeq ORF | 675 bp |
Locus ID | 362572 |
UniProt ID | Q6AYE8 |
Gene Summary | Ligand for the GFR-alpha-3-RET receptor complex but can also activate the GFR-alpha-1-RET receptor complex. Supports the survival of sensory and sympathetic peripheral neurons in culture and also supports the survival of dopaminergic neurons of the ventral mid-brain. Strong attractant of gut hematopoietic cells thus promoting the formation Peyer's patch-like structures, a major component of the gut-associated lymphoid tissue (By similarity).[UniProtKB/Swiss-Prot Function] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Neurotrophin selectivity in organizing topographic regeneration of nociceptive afferents
,Kelamangalath, L;Tang, X;Bezik, K;Sterling, N;Son, YJ;Smith, GM;,
Exp. Neurol.
,PubMed ID 26054884
[ARTN]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR209126 | Artn (Myc-DDK-tagged ORF) - Rat artemin (Artn), (10 ug) |
CNY 3,600.00 |
|
RR209126L1 | Lenti ORF clone of Artn (Myc-DDK-tagged ORF) - Rat artemin (Artn), (10 ug) |
CNY 6,080.00 |
|
RR209126L2 | Lenti ORF clone of Artn (mGFP-tagged ORF) - Rat artemin (Artn), (10 ug) |
CNY 6,000.00 |
|
RR209126L3 | Lenti ORF clone of Artn (Myc-DDK-tagged ORF) - Rat artemin (Artn), (10 ug) |
CNY 6,080.00 |
|
RR209126L4 | Lenti ORF clone of Artn (mGFP-tagged ORF) - Rat artemin (Artn), (10 ug) |
CNY 6,650.00 |