Cd3g (NM_001077646) Rat Untagged Clone
CAT#: RN208762
Cd3g (untagged ORF) - Rat CD3 molecule, gamma polypeptide (Cd3g), (10 ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN208762 representing NM_001077646
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCAGGGGAAAGGTTTGGCTGGCCTCTTCCTGGTGATCTCTCTTCTTCAAGGCACCATGGCCCAGC AAAAAGAAGAAAAGCATTTGGTAAAAGTGGATGACAGCCAAGGAGATGGCTCTGTACTTCTGACTTGTGA CTTCAATGAGAAGACTATCACATGGCTTAAAGATGGGCACAGAATAAGTCCTCCAAATGCAACTAAAAGC ACGTGGAATCTGGGCAACGGTGCCAAAGACCCTCGAGGCATGTATCAGTGCCGAGGAGCAAAGAAGAAGT CGCAGCTCCTGCAAGTGTACTACAGACTGTGTGAGAACTGCATTGAGCTAAATATGGGCACTGTGTCCGG CTTTATCTTCGCTGAAATCATCAGCATTTTCTTCCTTGCTGTTGGTGTATACTTCATTGCTGGACAGGAT GGAGTTCGCCAGTCAAGAGCTTCAGACAAGCAGACTCTGTTGCAAAATGAACAGGTCTACCAGCCCCTCA AGGACCGGGAATATGAACAGTACAGCCGTCTCCAAGGAAACCAAGTGAGAAAGAAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001077646 |
Insert Size | 549 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001077646.2, NP_001071114.1 |
RefSeq Size | 617 bp |
RefSeq ORF | 549 bp |
Locus ID | 300678 |
UniProt ID | Q64159 |
Gene Summary | Part of the TCR-CD3 complex present on T-lymphocyte cell surface that plays an essential role in adaptive immune response. When antigen presenting cells (APCs) activate T-cell receptor (TCR), TCR-mediated signals are transmitted across the cell membrane by the CD3 chains CD3D, CD3E, CD3G and CD3Z. All CD3 chains contain immunoreceptor tyrosine-based activation motifs (ITAMs) in their cytoplasmic domain. Upon TCR engagement, these motifs become phosphorylated by Src family protein tyrosine kinases LCK and FYN, resulting in the activation of downstream signaling pathways. In addition to this role of signal transduction in T-cell activation, CD3G plays an essential role in the dynamic regulation of TCR expression at the cell surface. Indeed, constitutive TCR cycling is dependent on the di-leucine-based (diL) receptor-sorting motif present in CD3G.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR208762 | Cd3g (Myc-DDK-tagged ORF) - Rat CD3 molecule, gamma polypeptide (Cd3g), (10 ug) |
CNY 3,990.00 |
|
RR208762L3 | Lenti ORF clone of Cd3g (Myc-DDK-tagged ORF) - Rat CD3 molecule, gamma polypeptide (Cd3g), (10 ug) |
CNY 6,080.00 |
|
RR208762L4 | Lenti ORF clone of Cd3g (mGFP-tagged ORF) - Rat CD3 molecule, gamma polypeptide (Cd3g), (10 ug) |
CNY 6,650.00 |