Emc9 (NM_001008296) Rat Untagged Clone
CAT#: RN207641
Emc9 (untagged ORF) - Rat family with sequence similarity 158, member A (Fam158a), (10 ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | Fam158a; RGD1308113 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN207641 representing NM_001008296
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGGAGGTGGAGATCTCCGCCCGAGCCTACGGGAAGATGTGTCTGCACGCCTCTCGGTACCCACACG CTGCTGTCAACGGGTTGTTGCTGGCTCCCGCGACGCGGTCCGGAGAATGTCTCTGCCTCACCGACTGTGT GCCCCTCTTCCACAGCCATCTGGCCTTGTCCGTCATGCTGGAGGTCGCGCTCAACCAGGTGGATGTGTGG GCAACGCAGGCCGGTCTGGTGGTAGCTGGGTACTACCATGCCAATGCGGTTTTGGATGATCAGAGCCCTG GGCCTCTGGCCTTGAAAATCGCTGGGCGAATTGCAGAATTCTTCCCCAACGCAGTGCTTATTATGCTGGA TAATAAGAAACTGGTAACTTGGCCTCGTGTACCTCCAGTCATTGTCCTGGAGAACCAGGGTCTTCAGTGG GTGCCTAAGGACAAGAACTTAGTGATGTGGAGAGATTGGGAGGAGTCACGGCAGATGGTGGGAGCACTGC TGGAGGGCCGGGCCCACCAGCATCTTGTGGACTTTGACTGCCACCTTGATGACATTCGGCAGGACTGGAC CAACCAGCGGCTCAACACTCAAATCACTCAATGGAGTGGTTCCACCGATGGACATGCCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001008296 |
Insert Size | 621 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001008296.1, NP_001008297.1 |
RefSeq Size | 845 bp |
RefSeq ORF | 621 bp |
Locus ID | 290224 |
UniProt ID | Q5U1W7 |
Gene Summary | Part of the endoplasmic reticulum membrane protein complex (EMC) that enables the energy-independent insertion into endoplasmic reticulum membranes of newly synthesized membrane proteins. Preferentially accommodates proteins with transmembrane domains that are weakly hydrophobic or contain destabilizing features such as charged and aromatic residues. Involved in the cotranslational insertion of multi-pass membrane proteins in which stop-transfer membrane-anchor sequences become ER membrane spanning helices. It is also required for the post-translational insertion of tail-anchored/TA proteins in endoplasmic reticulum membranes. By mediating the proper cotranslational insertion of N-terminal transmembrane domains in an N-exo topology, with translocated N-terminus in the lumen of the ER, controls the topology of multi-pass membrane proteins like the G protein-coupled receptors. By regulating the insertion of various proteins in membranes, it is indirectly involved in many cellular processes.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR207641 | Emc9 (Myc-DDK-tagged ORF) - Rat family with sequence similarity 158, member A (Fam158a), (10 ug) |
CNY 3,990.00 |
|
RR207641L3 | Lenti ORF clone of Emc9 (Myc-DDK-tagged ORF) - Rat family with sequence similarity 158, member A (Fam158a), (10 ug) |
CNY 6,080.00 |
|
RR207641L4 | Lenti ORF clone of Emc9 (mGFP-tagged ORF) - Rat family with sequence similarity 158, member A (Fam158a), (10 ug) |
CNY 6,650.00 |