Spin1 (NM_001024796) Rat Untagged Clone

CAT#: RN203467

Spin1 (untagged ORF) - Rat spindlin 1 (Spin1), (10 ug)



  "NM_001024796" in other vectors (3)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Spin
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN203467 representing NM_001024796
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGACCCCATTCGGGAAGACACCTGGCCAGCGGTCCAGAGCTGATGCAGGCCATGCTGGAGTCTCTG
CAAACATGATGAAGAAGAGGACATCTCACAAAAAACATCGGACCAGTGTGGGACCAAGCAAACCTGTGTC
CCAGCCCCGGCGGAACATCGTAGGCTGCAGGATCCAGCATGGGTGGAGAGAGGGCAACGGCCCTGTCACC
CAGTGGAAGGGGACTGTCCTGGACCAGGTGCCTGTGAACCCTTCCCTGTATCTCATAAAGTACGATGGAT
TTGACTGTGTCTATGGACTAGAGCTGAACAAGGATGACAGAGTCTCTGCACTTGAAGTCCTCCCTGACAG
AGTTGCAACATCTCGGATTAGCGATGCACACTTAGCGGACACAATGATTGGCAAAGCGGTGGAGCACATG
TTTGAAACAGAGGATGGCTCTAAAGATGAGTGGAGGGGGATGGTCTTGGCGCGGGCACCAGTCATGAACA
CATGGTTTTACATCACCTATGAGAAAGACCCTGTCTTGTACATGTACCAGCTCCTAGATGATTACAAAGA
AGGCGACCTCCGCATTATGCCCGATTCCAATGATTCGCCTCCAGCAGAAAGGGAGCCAGGAGAAGTTGTG
GACAGCCTGGTAGGCAAGCAAGTGGAATATGCCAAAGAAGACGGCTCGAAAAGGACTGGCATGGTCATCC
ATCAAGTAGAGGCCAAGCCCTCTGTCTATTTCATCAAGTTTGATGACGACTTCCATATTTACGTCTACGA
TTTGGTGAAAACATCCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001024796
Insert Size 789 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001024796.1, NP_001019967.1
RefSeq Size 1128 bp
RefSeq ORF 789 bp
Locus ID 361217
UniProt ID Q4V8J7
Gene Summary Chromatin reader that specifically recognizes and binds histone H3 both trimethylated at 'Lys-4' and asymmetrically dimethylated at 'Arg-8' (H3K4me3 and H3R8me2a) and acts as an activator of Wnt signaling pathway downstream of PRMT2. In case of cancer, promotes cell cancer proliferation via activation of the Wnt signaling pathway. Overexpression induces metaphase arrest and chromosomal instability. Localizes to active rDNA loci and promotes the expression of rRNA genes. May play a role in cell-cycle regulation during the transition from gamete to embryo. Involved in oocyte meiotic resumption, a process that takes place before ovulation to resume meiosis of oocytes blocked in prophase I: may act by regulating maternal transcripts to control meiotic resumption.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...