Tnfaip8l2 (NM_001014039) Rat Untagged Clone

CAT#: RN203253

Tnfaip8l2 (untagged ORF) - Rat tumor necrosis factor, alpha-induced protein 8-like 2 (Tnfaip8l2), (10 ug)



  "NM_001014039" in other vectors (3)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms RGD1310519
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN203253 representing NM_001014039
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGTCCTTCAGCTCAAAGAGTCTGGCACTACAAGCGGAGAAGAAGCTGCTGAGTAAAATGGCTGGTC
GGTCCGTGGCGCATCTCTTTATCGATGAGACTAGCAGCGAGGTGCTAGACGAGCTTTACCGCGTCTCCAA
AGAATACACGCACAGCCGGTCCAAGGCACAACGGGTGATCAAAGACCTCATCAAGGTGGCCGTCAAGGTG
GCGGTGCTGCACCGCAGTGGCTGCTTTAGCCCTGGGGAGCTGGCTCTGGCTACACGATTTCGCCAGAAGC
TGCGGCAGGGTGCGATGACTGCACTTAGCTTTGGTGAGGTGGACTTCACCTTTGAGGCTGCTGTGCTAGC
AGGTCTGCTCATCGAGTGCCGGGAGATTCTGCTGGAGCTGGTGGAGCACCACCTCACACCCAAGTCACAT
GACCGCATCAGACACGTGTTTGATCACTACTCTGACCCTGACCTGCTGACTGCCCTCTACGGGCCCGACT
TCACTCAGCACCTTGACAAGATCTGTGATGGGCTCCGGAAGCTTCTAGACGAGGGGAAGCTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001014039
Insert Size 555 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001014039.1, NP_001014061.1
RefSeq Size 1433 bp
RefSeq ORF 555 bp
Locus ID 310663
UniProt ID Q6AYJ8
Gene Summary Acts as a negative regulator of innate and adaptive immunity by maintaining immune homeostasis. Negative regulator of Toll-like receptor and T-cell receptor function. Prevents hyperresponsiveness of the immune system and maintains immune homeostasis. Inhibits JUN/AP1 and NF-kappa-B activation. Promotes Fas-induced apoptosis (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...