United States
Germany
Japan
United Kingdom
China
Atp5mc2 (NM_133556) Rat Untagged Clone
CAT＃: RN202995
Atp5g2 (untagged ORF) - Rat ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C2 (subunit 9) (Atp5g2), nuclear gene encoding mitochondrial protein, (10 ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Rat Untagged Clone |
| Tag | Tag Free |
| Synonyms | Atp5g2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>RN202995 representing NM_133556
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTATGCCTGCTCCAAGTTCGTCTCTACCCGCTCCCTGATCAGGAGCACCTCTCAGCTGCTGAGCCGTC CGCTCTCTGCAGTGGAGTTAAAGCGACCACAGATGCCCACAGATGAGGGCCTCAGCTGCTTGGCAGTCCG GCGGCCTCTGACCTCGCTTATCCCTAGCCGCAGCTTCCAAACCAGCGCCATTTCAAGGGACATTGACACA GCTGCCAAGTTCATTGGAGCTGGGGCTGCTACAGTTGGGGTGGCCGGTTCTGGAGCAGGAATTGGGACTG TTTTTGGGAGTCTCATCATTGGCTATGCCAGGAACCCCTCTCTGAAGCAGCAACTCTTCTCCTATGCGAT TCTGGGCTTCGCCCTCTCTGAGGCCATGGGGCTCTTTTGCCTAATGGTGGCCTTCCTCATCCTCTTCGCC ATGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_133556 |
| Insert Size | 426 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_133556.2, NP_598240.1 |
| RefSeq Size | 749 bp |
| RefSeq ORF | 426 bp |
| Locus ID | 171082 |
| UniProt ID | Q06646 |
| Gene Summary | component of mitochondrial ATPase; displays increased expression in pancreas after alcohol consumption [RGD, Feb 2006] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RR202995 | Atp5g2 (Myc-DDK-tagged ORF) - Rat ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C2 (subunit 9) (Atp5g2), nuclear gene encoding mitochondrial protein, (10 ug) |
CNY 1,800.00 |
|
| RR202995L3 | Lenti ORF clone of Atp5g2 (Myc-DDK-tagged ORF) - Rat ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C2 (subunit 9) (Atp5g2), nuclear gene encoding mitochondrial protein, (10 ug) |
CNY 6,080.00 |
|
| RR202995L4 | Lenti ORF clone of Atp5g2 (mGFP-tagged ORF) - Rat ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C2 (subunit 9) (Atp5g2), nuclear gene encoding mitochondrial protein, (10 ug) |
CNY 6,650.00 |
其它Atp5mc2产品
