Dnmt3l (NM_001003964) Rat Untagged Clone

CAT#: RN202766

Dnmt3l (untagged ORF) - Rat DNA (cytosine-5-)-methyltransferase 3-like (Dnmt3l), (10 ug)



  "NM_001003964" in other vectors (3)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN202766 representing NM_001003964
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGTTCCCGGGAGACACCTTCTTCCTGCTCTAAGACCCATGAAACCTTGAACCTGGAGACTCCGGAGA
GCTCTAGCACTGACCCTGACAGTCCCCTGGAAGAGCAATGGCCGAAATCAGCCCCAGATCTGAAAGAGGA
AGACAGCATGGATATGGTACTGGAAGACTCCAAGGAGCCTCTAACCCCTTCCTCACCGCCGACAGGCAGA
GAGGTCATCAGGTACGAAGTCAACGTGAACCAGCGGAACATCGAAGACATCTGCCTCTGTTGCGGATCTC
TCCAGGTGTACGCTCAGCACCCCTTGTTTGAGGGGGGAATTTGTGCCCCGTGTAAGGACAAGTTCCTGGA
GACCCTCTTCCTATACGACGAGGATGGACACCAGAGCTACTGTACCATCTGCTGCTCCGGGCATACCCTG
TTCATCTGCGAGAGCCCCGACTGTACCAGATGCTACTGTTTCGAGTGTGTGGATATCCTGGTGGGCCCCG
GGACCTCGGAGCGCATCAATGCCATGGCCTGCTGGGTTTGCTTCCTGTGCCTGCCTTTCTCCCGGAGCGG
ACTGCTGCAGAGGCGCAAGAAGTGGCGTCACCAGCTGAAGGCCTTCCATGACCGAGAGGGGGCAAGCCCT
GTGGAGATATACAAGACTGTGTCTGCATGGAAAAGACAGCCAGTGAGGGTGCTGAGTCTTTTTGGGAATA
TTGATAAAGAACTAAAGAGTTTGGGCTTTTTGGAAAGCAGTTCTGGTTCTGAGGGAGGAACGCTGAAGTA
CGTGGAAGATGTCACCAATGTCGTGAGGAGAGAAGTGGAGAAATGGGGTCCCTTTGACTTGGTGTATGGC
TCAACCCAGCCCCTAGGCTATTCTTGTGACCGCTGTCCTGGCTGGTACATGTTCCAGTTCCACCGGATCC
TGCAGTATGCCCGGCCTCGCCAAGACAGCCAGCAGCCCTTCTTCTGGATATTTGTGGACAATCTGCTGCT
GACTGAAGATGACCAAGAGACAACTGTCCGCTTCCTTCAGACAGAGGCTGTGACCCTCCAGGATGTCCGC
GGCAGAGTCCTCCAGAATGCTATGAGGGTGTGGAGCAACATTCCAGGGCTGAAGAGCAAGCACGCGGACC
TGACCCCTAAGGAAGAGCAGTCTCTGCAAACCCAAGTCAGAACCAGAAGCAAGCTGGCCGCCCAGAAAGT
TGACTCCCTAGTGAAGTACTGCCTTCTCCCCCTGAGAGAGTACTTCAAGTATTTTTCTCAGAACTCACTT
CCTCTTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001003964
Insert Size 1269 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001003964.1, NP_001003964.1
RefSeq Size 1689 bp
RefSeq ORF 1269 bp
Locus ID 309680
UniProt ID Q1LZ50
Gene Summary Catalytically inactive regulatory factor of DNA methyltransferases that can either promote or inhibit DNA methylation depending on the context. Essential for the function of DNMT3A and DNMT3B: activates DNMT3A and DNMT3B by binding to their catalytic domain. Acts by accelerating the binding of DNA and S-adenosyl-L-methionine (AdoMet) to the methyltransferases and dissociates from the complex after DNA binding to the methyltransferases (By similarity). Recognizes unmethylated histone H3 lysine 4 (H3K4me0) and induces de novo DNA methylation by recruitment or activation of DNMT3 (By similarity). Plays a key role in embryonic stem cells and germ cells. In germ cells, required for the methylation of imprinted loci together with DNMT3A. In male germ cells, specifically required to methylate retrotransposons, preventing their mobilization. Plays a key role in embryonic stem cells (ESCs) by acting both as an positive and negative regulator of DNA methylation. While it promotes DNA methylation of housekeeping genes together with DNMT3A and DNMT3B, it also acts as an inhibitor of DNA methylation at the promoter of bivalent genes. Interacts with the EZH2 component of the PRC2/EED-EZH2 complex, preventing interaction of DNMT3A and DNMT3B with the PRC2/EED-EZH2 complex, leading to maintain low methylation levels at the promoters of bivalent genes. Promotes differentiation of ESCs into primordial germ cells by inhibiting DNA methylation at the promoter of RHOX5, thereby activating its expression (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...