Synj2bp (NM_022599) Rat Untagged Clone

CAT#: RN202677

Synj2bp (untagged ORF) - Rat synaptojanin 2 binding protein (Synj2bp), (10 ug)



  "NM_022599" in other vectors (3)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Omp25
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN202677 representing NM_022599
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACGGACGGGTGGATTATTTAGTCTCCGAGGAAGAGATCAACCTGACCAGAGGACCCTCGGGGCTGG
GCTTCAACATCGTCGGTGGGACAGATCAACAGTATGTCTCCAATGACAGTGGCATCTACGTCAGCCGCAT
CAAAGAGGATGGGGCTGCGGCCCGGGATGGGCGGCTCCAGGAGGGTGATAAGATCCTCTCGGTAAATGGC
CAAGACCTGAAGAACCTGTTGCACCAAGATGCCGTAGACCTCTTCCGTAATGCAGGATATGCCGTGTCCC
TGAGAGTGCAGCACAGGTTACCAGTGCAGAATGGACCTATAGTTCATCGAGGCGACGGAGAGCCGAGTGG
AGTTCCTGTAGCTGTGGTGCTGCTGCCAGTGTTTGCCCTTACCCTGGTAGCAGTTTGGGCCTTCGTGAGA
TACCGAAAGCAGCTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_022599
Insert Size 438 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_022599.2, NP_072121.2
RefSeq Size 5811 bp
RefSeq ORF 438 bp
Locus ID 64531
UniProt ID Q9WVJ4
Gene Summary binds and recruits synaptojanin 2A to mitochondria; facilitates synaptojanin 2A mediated inositol phosphate modification activity that may regulate intracellular distribution of mitochondria [RGD, Feb 2006]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...