Smarce1 (NM_001024993) Rat Untagged Clone

CAT#: RN202500

Smarce1 (untagged ORF) - Rat SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 (Smarce1), (10 ug)



  "NM_001024993" in other vectors (3)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms BAF57; RGD1304726
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN202500 representing NM_001024993
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCAAAAAGACCATCTTATGCCCCACCTCCCACCCCAGCTCCTGCAACAGCGTCCTCCGGCATTACAA
TCCCAAAGCCTCCAAAGCCACCAGATAAGCCGCTCATGCCCTACATGAGGTACAGCAGAAAGGTCTGGGA
CCAAGTAAAGGCTTCCAACCCTGACCTAAAGTTGTGGGAGATTGGCAAGATTATTGGTGGCATGTGGCGA
GATCTCACTGATGAAGAGAAACAAGAATATTTAAACGAGTACGAAGCAGAAAAGATAGAGTACAATGAAT
CTATGAAGGCCTATCACAATTCCCCTGCATACCTTGCATATATTAATGCAAAAAGTCGTGCGGAAGCTGC
ATTAGAGGAAGAAAGTCGACAGAGACAGTCGCGCATGGAGAAAGGAGAGCCTTACATGAGCATTCAGCCT
GCGGAGGACCCAGACGATTATGATGACGGCTTTTCAATGAAGCATACAGCCACTGCCCGTTTCCAGAGAA
ACCACCGCCTCATCAGTGAGATCCTCAGTGAGAGTGTGGTACCTGATGTGCGGTCGGTTGTCACAACAGC
TAGAATGCAAGTCCTCAAGCGACAGGTCCAGTCTTTAATGGTTCATCAGCGGAAACTAGAAGCCGAGCTT
CTTCAGATAGAGGAACGACACCAGGAAAAGAAGAGGAAATTCCTGGAAAGCACAGACTCCTTTAACAATG
AGCTTAAAAGGCTGTGTGGTCTGAAGGTGGAAGTGGACATGGAGAAGATTGCAGCAGAGATCGCACAGGC
GGAGGAGCAGGCCCGCAAAAGGCAGGAGGAGAGGGAGAAGGAGGCAGCCGAGCAAGCTGAGCGCAGCCAG
GGCAGCATCGCCCCCGAGGAAGAGCAAGTGGCGAACAAAGCCGAGGAGAAGAAGGATGAGGAGAACATCC
CGATGGAGACAGAGGAGACACACCTTGAAGACACTGCGGAGAACCAGCAGAATGGTGAAGAAGGCACATC
TACTCCTGAGGACAAGGAGAGTGGGCAGGAGGGGGTTGACAGCATGGAGGTGGAAGGGACCAGTGACAGT
AACACCGGCTCAGAGAGCAACAGCGCAACGGTGGAGGAGCCGCCCACGGACCCTGTGCCAGAAGACGAGA
AGAAGGAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001024993
Insert Size 1131 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001024993.1, NP_001020164.1
RefSeq Size 2200 bp
RefSeq ORF 1131 bp
Locus ID 303518
UniProt ID Q56A18
Gene Summary Involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). Component of SWI/SNF chromatin remodeling complexes that carry out key enzymatic activities, changing chromatin structure by altering DNA-histone contacts within a nucleosome in an ATP-dependent manner. Belongs to the neural progenitors-specific chromatin remodeling complex (npBAF complex) and the neuron-specific chromatin remodeling complex (nBAF complex). During neural development a switch from a stem/progenitor to a postmitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to postmitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth (By similarity). Required for the coactivation of estrogen responsive promoters by SWI/SNF complexes and the SRC/p160 family of histone acetyltransferases (HATs). Also specifically interacts with the CoREST corepressor resulting in repression of neuronal specific gene promoters in non-neuronal cells (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...