Dpy30 (NM_173117) Rat Untagged Clone
CAT#: RN201438
Dpy30 (untagged ORF) - Rat dpy-30 homolog (C. elegans) (Dpy30), (10 ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | Aip1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN201438 representing NM_173117
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGTCAGAGCAGATGCTGGAGGGACAGACACAGGTTGCAGAAAACCCTCACTCTGAGTACGGGCTCA CAGACAGCGTTGAGAGAATAGTTGAAAATGAGAAGATTAATGCAGAAAAGTCATCAAAACAGAAGGTGGA TCTACAGTCCTTGCCCACCCGTGCCTACCTGGACCAGACAGTTGTGCCTATCTTATTACAGGGACTTGCT GTGCTCGCAAAGGAAAGACCACCAAATCCCATCGAGTTTCTAGCATCTTATCTTTTAAAAAATAAGGCAC AGTTTGAAGATCGAAATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_173117 |
Insert Size | 300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_173117.2, NP_775140.2 |
RefSeq Size | 719 bp |
RefSeq ORF | 300 bp |
Locus ID | 286897 |
UniProt ID | Q8K3E7 |
Gene Summary | As part of the MLL1/MLL complex, involved in the methylation of histone H3 at 'Lys-4', particularly trimethylation. Histone H3 'Lys-4' methylation represents a specific tag for epigenetic transcriptional activation. May play some role in histone H3 acetylation. In embryonic stem cells, may play a crucial role in retinoic acid-induced differentiation along the neural lineage, regulating gene induction and H3 'Lys-4' methylation at key developmental loci. May also play an indirect or direct role in endosomal transport (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR201438 | Dpy30 (Myc-DDK-tagged ORF) - Rat dpy-30 homolog (C. elegans) (Dpy30), (10 ug) |
CNY 3,990.00 |
|
RR201438L3 | Lenti ORF clone of Dpy30 (Myc-DDK-tagged ORF) - Rat dpy-30 homolog (C. elegans) (Dpy30), (10 ug) |
CNY 6,080.00 |
|
RR201438L4 | Lenti ORF clone of Dpy30 (mGFP-tagged ORF) - Rat dpy-30 homolog (C. elegans) (Dpy30), (10 ug) |
CNY 6,650.00 |