United States
Germany
Japan
United Kingdom
China
Smim20 (NM_001134639) Rat Untagged Clone
CAT＃: RN201330
RGD1565192 (untagged ORF) - Rat similar to 1810013D10Rik protein (RGD1565192), (10 ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Rat Untagged Clone |
| Tag | Tag Free |
| Synonyms | RGD1565192 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>RN201330 representing NM_001134639
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCGCGGCCCGGAACCTGCGCACCGCGCTCATATTCGGAGGCTTCATCTCTATGGTCGGAGCCGCCT TCTACCCTATCTACTTCCGGCCCCTTCTGCGGCTGGAAGAATACCAGAAGGAGCAGGCTGTAAATCGAGC TGGTATCGTCCAGGAAGATGTGCAGCCACCAGGGTTGAAAGTGTGGTCTGATCCGTTTGGCAGGAAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001134639 |
| Insert Size | 210 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001134639.2, NP_001128111.2 |
| RefSeq Size | 922 bp |
| RefSeq ORF | 210 bp |
| Locus ID | 501923 |
| UniProt ID | C0HLM6 |
| Gene Summary | Component of the MITRAC (mitochondrial translation regulation assembly intermediate of cytochrome c oxidase complex) complex, that regulates cytochrome c oxidase assembly (By similarity). Promotes the progression of complex assembly after the association of Mt-Co1/Cox11 with Cox4I1 and Cox6c (By similarity). Chaperone-like assembly factor required to stabilize newly synthesized Mt-Co1/Cox1 and to prevent its premature turnover (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RR201330 | RGD1565192 (Myc-DDK-tagged ORF) - Rat similar to 1810013D10Rik protein (RGD1565192), (10 ug) |
CNY 3,990.00 |
|
| RR201330L3 | Lenti ORF clone of RGD1565192 (Myc-DDK-tagged ORF) - Rat similar to 1810013D10Rik protein (RGD1565192), (10 ug) |
CNY 6,080.00 |
|
| RR201330L4 | Lenti ORF clone of RGD1565192 (mGFP-tagged ORF) - Rat similar to 1810013D10Rik protein (RGD1565192), (10 ug) |
CNY 6,650.00 |
