Kdm8 (NM_001037196) Rat Untagged Clone

CAT#: RN201317

Kdm8 (untagged ORF) - Rat jumonji domain containing 5 (Jmjd5), (10 ug)



  "NM_001037196" in other vectors (3)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Jmjd5; RGD1304823
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN201317 representing NM_001037196
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCAGAGGACACTACAGAGCCCCTAGTGGGGCCCAGCACCCTCTGGAAGGACCTCAGGGCGCTCCTGC
CAGACACAGAGGAGGAGCTGAAGCTGGATCTCAGTGAGAAGGTGGACAGGAGCATGGCTACGCTGCTACG
GCAGGCTTTGGGTCTGTTCTATGAAGGCCGTTGGCAGAAGTGCCTGCAGGCCAGTGAGGCTGTCCTGGAC
TACTCCTGGGAAAAGCTCAACACTGGTCCCTGGCGAGATGTAGACAAGGAATGGCGCCGGGTATATTCCT
TCGGCTGCCTCCTGAAGACCCTGTGCCTGTGCCAGGCACCACAGAAGGCCACTGCTGTGGCTGAAGCACT
GCGGGTGTGTGACATGGGCCTGTTGATGGGGGCAGCCATCCTTGGGGACATTCTTCTCAAAGTTGCTACA
GTCCTCCAGACACATCTGCTCCCTAGAAAGCAGCCTGCCTGTGGCCCTCACCAGGATCAGCCTGCTACCA
AGAAGGCAAAGCATGATGCCAGCTCAACTCCTGATGTGGTATTAGATCGGGAAGTGCCCAGGCTTCGCTG
CCCACCTCTGCAGCACTTCAAGAAGCATTTTCTAGTTCCTGGGAGACCTGTGATCTTGGAAGGTGTGGCT
GACCACTGGCCGTGCATGAAGAAGTGGAGTCTACAGTACATCCAGGAGATTGCTGGCTGCCGCACTGTCC
CCGTGGAAGTGGGTTCAAGATACACAGATGAAGACTGGTCCCAGACTCTCATGACAGTCAATGAGTTCAT
CCACAAATACATTCTGAGCGAGGCAAAGGATGTCGGGTACCTTGCTCAACACCAGCTGTTCGACCAGATC
CCAGAGTTGAAGCAGGACATCAGCATCCCCGATTACTGTTGCCTGGGCAATGGAGAAGAGGAAGAGATCA
CTATCAATGCCTGGTTTGGTCCTCAAGGAACCATCTCCCCATTGCATCAGGACCCCCAGCAGAACTTCCT
GGTCCAGGTGTTAGGAAGGAAGTACATCCGGCTGTATTCTCCGCAAGAGTCTGAGGCAGTGTACCCTCAT
GAGACACACATTCTTCATAACACCAGCCAGGTTGATGTGGAAAACCCCGACCTAGAGAAGTTCCCCAAGT
TCACCGAGGCCCCGTTTCTGTCCTGCATTCTGTCCCCAGGAGACACCCTCTTTATACCTGCTAAGTACTG
GCATTACGTGCGCTCCCTGGACCTGAGCTTCTCTGTCAGCTTCTGGTGGTCATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001037196
Insert Size 1245 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001037196.1, NP_001032273.1
RefSeq Size 2460 bp
RefSeq ORF 1245 bp
Locus ID 308976
UniProt ID Q497B8
Gene Summary Bifunctional enzyme that acts both as an endopeptidase and 2-oxoglutarate-dependent monoxygenase. Endopeptidase that cleaves histones N-terminal tails at the carboxyl side of methylated arginine or lysine residues, to generate 'tailless nucleosomes', which may trigger transcription elongation. Preferentially recognizes and cleaves monomethylated and dimethylated arginine residues of histones H2, H3 and H4. After initial cleavage, continues to digest histones tails via its aminopeptidase activity. Upon DNA damage, cleaves the N-terminal tail of histone H3 at monomethylated lysine residues, preferably at monomethylated 'Lys-9' (H3K9me1). The histone variant H3F3A is the major target for cleavage. Additionnally, acts as Fe(2+) and 2-oxoglutarate-dependent monoxygenase, catalyzing (R)-stereospecific hydroxylation at C-3 of 'Arg-137' of RPS6 and 'Arg-141' of RCCD1, but the biological significance of this activity remains to be established. Regulates mitosis through different mechanisms: Plays a role in transcriptional repression of satellite repeats, possibly by regulating H3K36 methylation levels in centromeric regions together with RCCD1. Possibly together with RCCD1, is involved in proper mitotic spindle organization and chromosome segregation. Negatively regulates cell cycle repressor CDKN1A/p21, which controls G1/S phase transition. Required for G2/M phase cell cycle progression. Regulates expression of CCNA1/cyclin-A1, leading to cancer cell proliferation. Also, plays a role in regulating alpha-tubulin acetylation and cytoskeletal microtubule stability involved in epithelial to mesenchymal transition (By similarity). Regulates the circadian gene expression in the liver (By similarity). Represses the transcriptional activator activity of the CLOCK-ARNTL/BMAL1 heterodimer in a catalytically-independent manner (By similarity). Negatively regulates the protein stability and function of CRY1; required for AMPK-FBXL3-induced CRY1 degradation (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...