Atp5pd (NM_019383) Rat Untagged Clone
CAT#: RN201071
Atp5h (untagged ORF) - Rat ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d (Atp5h), nuclear gene encoding mitochondrial protein, (10 ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | Atp5h; Atp5jd; Atpq |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN201071 representing NM_019383
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTGGGCGCAAACTTGCTCTAAAAACCATCGATTGGGTATCTTTTGTGGAGATCATGCCCCAAAACC AGAAGGCAATTGGAAACGCTCTGAAGTCCTGGAATGAGACCTTCCACACCAGGTTGGCTAGTCTGTCTGA GAAACCACCAGCGATTGACTGGGCTTACTACAGGGCCAATGTGGACAAGCCTGGCTTGGTGGATGATTTT AAAAACAAGTATAATGCTCTGAAGATCCCTGTGCCTGAGGATAAATACACAGCCCTAGTGGACGCCGAGG AGAAGGAGGATGTGAAGAACTGTGCCCAGTTCGTGACTGGATCTCAGGCTAGGGTCCGGGAATATGAGAA GCAGCTGGAGAAAATAAAGAACATGATTCCCTTTGACCAGATGACGATTGATGACTTGAATGAGGTCTTC CCTGAAACCAAGCTGGACAAGAGGAAGTACCCATACTGGCCCCATCAGCCCATCGAGAACCTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_019383 |
Insert Size | 486 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_019383.2, NP_062256.1 |
RefSeq Size | 626 bp |
RefSeq ORF | 486 bp |
Locus ID | 641434 |
UniProt ID | P31399 |
Gene Summary | subunit d of mitochondrial H(+)-ATP synthase [RGD, Feb 2006] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR201071 | Atp5h (Myc-DDK-tagged ORF) - Rat ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d (Atp5h), nuclear gene encoding mitochondrial protein, (10 ug) |
CNY 1,920.00 |
|
RR201071L1 | Lenti ORF clone of Atp5h (Myc-DDK-tagged ORF) - Rat ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d (Atp5h), nuclear gene encoding mitochondrial protein, (10 ug) |
CNY 6,080.00 |
|
RR201071L2 | Lenti ORF clone of Atp5h (mGFP-tagged ORF) - Rat ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d (Atp5h), nuclear gene encoding mitochondrial protein, (10 ug) |
CNY 4,320.00 |
|
RR201071L3 | Lenti ORF clone of Atp5h (Myc-DDK-tagged ORF) - Rat ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d (Atp5h), nuclear gene encoding mitochondrial protein, (10 ug) |
CNY 6,080.00 |
|
RR201071L4 | Lenti ORF clone of Atp5h (mGFP-tagged ORF) - Rat ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d (Atp5h), nuclear gene encoding mitochondrial protein, (10 ug) |
CNY 6,650.00 |