Dclk1 (NM_053343) Rat Untagged Clone

CAT#: RN200772

Dclk1 (untagged ORF) - Rat doublecortin-like kinase 1 (Dclk1), (10 ug)



  "NM_053343" in other vectors (3)

CNY 5,610.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Ania4; Cpg16; Dcamkl1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN200772 representing NM_053343
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTAGAACTCATAGAAGTTAATGGAACCCCTGGCAGTCAGCTCTCCACTCCGCGCTCCGGCAAGTCAC
CAAGTCCATCGCCCACCAGCCCAGGAAGCCTGCGGAAGCAGAGGATCTCTCAGCATGGCGGCTCCTCCAC
TTCACTTTCATCCACAAAAGTCTGCAGCTCAATGGATGAGAACGATGGCCCTGGGGAAGAAGAGTCCGAC
GAAGGTTTCCAGATTCCTGCCACAATAACAGAGAGATACAAAGTCGGGAGAACAATAGGAGATGGAAATT
TCGCTGTTGTCAAGGAATGTATAGAGAGGTCGACTGCTCGGGAGTATGCCCTGAAAATTATCAAGAAAAG
TAAATGCCGAGGCAAAGAACACATGATCCAAAACGAGGTCTCCATCTTAAGGAGAGTGAAGCATCCGAAC
ATTGTTCTCCTGATTGAAGAGATGGATGTGCCGACTGAACTATATCTTGTAATGGAGTTAGTAAAGGGTG
GAGACCTTTTCGATGCCATCACTTCCACTAGCAAATACACAGAGCGGGATGCCAGTGGGATGCTGTACAA
CCTGGCCAGTGCCATTAAATACCTGCACAGCCTGAACATCGTCCATCGTGACATCAAGCCAGAGAACCTG
CTGGTGTATGAGCACCAGGATGGCAGTAAGTCACTCAAGTTGGGTGACTTTGGCCTGGCCACAATTGTCG
ATGGCCCCCTGTACACAGTCTGTGGCACCCCAACTTATGTGGCTCCAGAAATCATTGCAGAGACTGGATA
TGGCCTCAAGGTGGACATCTGGGCAGCTGGCGTGATCACTTATATCCTGTTGTGTGGTTTCCCTCCATTC
CGTGGAAGTGGGGATGACCAGGAGGTGCTTTTTGACCAGATCTTGATGGGCCAAGTGGACTTTCCATCTC
CGTATTGGGACAATGTGTCAGATTCTGCTAAGGAGCTCATCAACATGATGCTGTTGGTTAACGTGGACCA
GAGATTTTCAGCCGTGCAAGTCCTTGAGCACCCCTGGGTTAACGATGATGGCCTCCCAGAAAATGAACAT
CAGCTGTCAGTAGCTGGCAAGATCAAGAAGCATTTCAACACGGGCCCCAAGCCGAGCAGCACGGCAGCTG
GAGTTTCTGTAATAGCAACCACCGCTCTTGATAAGGAGAGGCAGGTTTTCCGACGAAGACGCAACCAGGA
TGTGAGGGGCCGGTACAAGGCACAGCCAGCTCCACCAGAACTCAACTCGGAATCAGAAGACTACTCCCCC
AGCTCCTCTGAGACTGTCCGCTCCCCCAATTCGCCCTTTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_053343
Insert Size 1302 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_053343.3, NP_445795.1
RefSeq Size 6903 bp
RefSeq ORF 1302 bp
Locus ID 83825
UniProt ID O08875
Gene Summary This gene encodes a member of the protein kinase superfamily and the doublecortin family. The typical protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmodulin-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. The microtubule-polymerizing activity of the protein is independent of its protein kinase activity. This gene is involved in several different cellular processes, including neuronal migration, retrograde transport, neuronal apoptosis and neurogenesis. Multiple transcript variants generated by two alternative promoter usage and alternative splicing have been found, but the full-length nature of the variant produced from the 5' promoter has not been determined. Current reference sequence data represents two alternatively spliced transcript variants produced from the 3' promoter and their protein products lack the doublecortin domain.[provided by RefSeq, Sep 2010]
Transcript Variant: This variant [1, also known as DCLK-short-A, DCK-beta2, KIAA0369-BL or cpg16 (candidate plasticity gene 16)] is produced from the 3' promoter. It encodes isoform 1, which contains a serine/proline-rich domain and a protein kinase domain. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...