Cd300lf (NM_001025111) Rat Untagged Clone

CAT#: RN200569

Cd300lf (untagged ORF) - Rat CD300 molecule-like family member f (Cd300lf), (10 ug)



  "NM_001025111" in other vectors (3)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms CD300f; RGD1309733
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN200569 representing NM_001025111
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCATTTGTCATTGCTGGCTCTCTTTCTCTTCTGGATCTCAGGCTGCTTCACTGCTCAGGATCCAGTCA
CAGGTCCAGAGGAGGTGAGCGGTTACGAGCAGGGCTCCCTGACAGTGTGGTGTCGATATGGCTCATGGTG
GAAGGATTACAGCAAGTACTGGTGCCGAGGACCTAAGAGGAGTTCCTGTGAGATTCGAGTTGAAACCGAT
GCATCAGAGCGCTTGGTGAAGGAGAACCATGTGTCCATCAGGGACGACCAGACAAACTTCACCTTCACAG
TGACCATGGAGGACCTGAGGATGAGCGATGCTGGCATTTACTGGTGTGGAATTACAAAGGCTGGATATGA
TCACATGTTTAAAGTTCATGTGAGCATTAACCCAGTGCCAACAACGCCCACCACCACCTCCACCACCACC
ATCTTCACAGTGACAACCACTGTAAAAGAGACCAGCACGCTTTCAACGCAGACCAGCCACTACTCTGATA
ACAGGTATGACAGTGGTGGTGTCGGCGACGGTAATGGGTTTCTGGATCTCAGCGTGCTCCTCCCAGTCAT
CTCTGCAGCCCTGTTGCTTCTCTTGCTGGTGGTCTCACTAATTGCTTGGAGGATGGTGAGGAGACAGAAG
AAAGCTGCTGGACCACCCTCAGGGCAGGCTGATTCTGTGACTCACATCTTGTGTCCCCCCAAACCCCATG
TACAGCCTCTGGAGGATGATCTCTGTTATGCAAACCTGTCACTGCAGCAGCCCAGAACCTCCCCTTTGAA
AAAGGGCTCCTCCATGTCCTCCTCTGGCAAGGACCACCAAGAGGAAGTGGAATACGTCACCATGGCTCCC
TTCCCTAGGGAGGAGATTTCATACGCTGCTCTGTCTTTGGCGAGCTTGGGTCAGGAACCTACTTACAGCA
ACACTGCCTGCCTTGTCACCCATGGTCCCAGGACAAACCTTGGAGAGGAGACCACAGAGTACAGCAGCAT
CAGGAGGCCCATGCCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001025111
Insert Size 999 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001025111.1, NP_001020282.1
RefSeq Size 1818 bp
RefSeq ORF 999 bp
Locus ID 287818
UniProt ID Q566E6
Gene Summary Acts as an inhibitory receptor for myeloid cells and mast cells. Positively regulates the phagocytosis of apoptotic cells (efferocytosis) via phosphatidylserine (PS) recognition; recognizes and binds PS as a ligand which is expressed on the surface of apoptotic cells. Plays an important role in the maintenance of immune homeostasis, by promoting macrophage-mediated efferocytosis and by inhibiting dendritic cell-mediated efferocytosis. Negatively regulates Fc epsilon receptor-dependent mast cell activation and allergic responses via binding to ceramide and sphingomyelin which act as ligands. May act as a coreceptor for interleukin 4 (IL-4). Associates with and regulates IL-4 receptor alpha-mediated responses by augmenting IL-4- and IL-13-induced signaling. Negatively regulates the Toll-like receptor (TLR) signaling mediated by MYD88 and TRIF through activation of PTPN6/SHP-1 and PTPN11/SHP-2. Inhibits osteoclast formation. Induces macrophage cell death upon engagement.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...