Igf1 (NM_001082477) Rat Untagged Clone
CAT#: RN200510
Igf1 (untagged ORF) - Rat insulin-like growth factor 1 (Igf1), transcript variant 1, (10 ug)
CNY 3,990.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | IGF |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN200510 representing NM_001082477
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGCGCACCTCCAATAAAGATACACATCATGTCGTCTTCACATCTCTTCTACCTGGCACTCTGCTTGC TCACCTTTACCAGCTCGGCCACAGCCGGACCAGAGACCCTTTGCGGGGCTGAGCTGGTGGACGCTCTTCA GTTCGTGTGTGGACCAAGGGGCTTTTACTTCAACAAGCCCACAGGCTATGGCTCCAGCATTCGGAGGGCA CCACAGACGGGCATTGTGGATGAGTGTTGCTTCCGGAGCTGTGATCTGAGGAGGCTGGAGATGTACTGTG CTCCGCTGAAGCCTACAAAGTCAGCTCGTTCCATCCGGGCCCAGCGCCACACTGACATGCCCAAGACTCA GAAGTCCCAGCCCCTATCGACACACAAGAAAAGGAAGCTGCAAAGGAGAAGGAAAGGAAGTACACTTGAA GAACACAAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001082477 |
Insert Size | 432 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001082477.2, NP_001075946.2 |
RefSeq Size | 1582 bp |
RefSeq ORF | 432 bp |
Locus ID | 24482 |
UniProt ID | P08025 |
Gene Summary | growth factor; plays a major role in mammalian growth [RGD, Feb 2006] Transcript Variant: This variant (1) differs in the 5' UTR and 5' coding region, compared to variant 3. These differences cause translation initiation from a distinct start codon and result in an isoform (a) with a novel C-terminus, compared to isoform c. This isoform is also known as IIC. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
The Effects of Insulin-Like Growth Factor-1 Gene Therapy and Cell Transplantation on Rat Acute Wound Model
,Amiri, FT;Fathabadi, FF;Rad, MM;Piryae, A;Ghasemi, A;,
Iran Red Crescent Med J.
[Igf1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR200510 | Igf1 (Myc-DDK-tagged ORF) - Rat insulin-like growth factor 1 (Igf1), transcript variant 1, (10 ug) |
CNY 3,990.00 |
|
RR200510L3 | Lenti ORF clone of Igf1 (Myc-DDK-tagged ORF) - Rat insulin-like growth factor 1 (Igf1), transcript variant 1, (10 ug) |
CNY 6,080.00 |
|
RR200510L4 | Lenti ORF clone of Igf1 (mGFP-tagged ORF) - Rat insulin-like growth factor 1 (Igf1), transcript variant 1, (10 ug) |
CNY 6,650.00 |