Igf1 (NM_001082478) Rat Untagged Clone
CAT#: RN200508
Igf1 (untagged ORF) - Rat insulin-like growth factor 1 (Igf1), transcript variant 3, (10 ug)
CNY 1,800.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | IGF |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN200508 representing NM_001082478
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGAAAATCAGCAGTCTTCCAACTCAATTATTTAAGATCTGCCTCTGTGACTTCTTGAAGATAAAGA TACACATCATGTCGTCTTCACATCTCTTCTACCTGGCACTCTGCTTGCTCACCTTTACCAGCTCGGCCAC AGCCGGACCAGAGACCCTTTGCGGGGCTGAGCTGGTGGACGCTCTTCAGTTCGTGTGTGGACCAAGGGGC TTTTACTTCAACAAGCCCACAGGCTATGGCTCCAGCATTCGGAGGGCACCACAGACGGGCATTGTGGATG AGTGTTGCTTCCGGAGCTGTGATCTGAGGAGGCTGGAGATGTACTGTGCTCCGCTGAAGCCTACAAAGTC AGCTCGTTCCATCCGGGCCCAGCGCCACACTGACATGCCCAAGACTCAGAAGTCCCAGCCCCTATCGACA CACAAGAAAAGGAAGCTGCAAAGGAGAAGGAAAGGAAGTACACTTGAAGAACACAAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_001082478 |
Insert Size | 480 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001082478.1, NP_001075947.1 |
RefSeq Size | 1879 bp |
RefSeq ORF | 480 bp |
Locus ID | 24482 |
UniProt ID | P08025 |
Gene Summary | growth factor; plays a major role in mammalian growth [RGD, Feb 2006] Transcript Variant: This variant (3) represents the longest variant and encodes isoform c. This isoform is also known as IB. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
The Effects of Insulin-Like Growth Factor-1 Gene Therapy and Cell Transplantation on Rat Acute Wound Model
,null,
Iranian Red Crescent Medical Journal
,PubMed ID 25558384
[Igf1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR200508 | Igf1 (Myc-DDK-tagged ORF) - Rat insulin-like growth factor 1 (Igf1), transcript variant 3, (10 ug) |
CNY 3,990.00 |
|
RR200508L3 | Lenti ORF clone of Igf1 (Myc-DDK-tagged ORF) - Rat insulin-like growth factor 1 (Igf1), transcript variant 3, (10 ug) |
CNY 6,080.00 |
|
RR200508L4 | Lenti ORF clone of Igf1 (mGFP-tagged ORF) - Rat insulin-like growth factor 1 (Igf1), transcript variant 3, (10 ug) |
CNY 6,650.00 |