Crem (NM_017334) Rat Untagged Clone
CAT#: RN200401
Crem (untagged ORF) - Rat cAMP responsive element modulator (Crem), transcript variant 2, (10 ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | Icer |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN200401 representing NM_017334
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCAAAAGCCCAACATGGCTGTAACTGGAGATGAAACTGATGAGGAGACTGACCTTGCCCCAAGTCACA TGGCTGCTGCCACAGGTGACATGCCAACTTACCAGATCCGAGCTCCTACTACTGCTTTGCCACAAGGTGT GGTGATGGCTGCCTCACCAGGGAGTCTGCACAGTCCCCAGCAACTAGCAGAAGAAGCAACTCGAAAGCGG GAGCTGAGGCTGATGAAAAACAGGGAAGCTGCTAAAGAATGTCGACGTCGAAAGAAAGAGTATGTGAAGT GTCTGGAGAGCCGAGTCGCAGTGCTGGAAGTTCAGAACAAGAAGCTTATAGAGGAGCTTGAAACCTTGAA AGACATTTGCTCTCCCAAAACAGATTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_017334 |
Insert Size | 378 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_017334.2, NP_059030.2 |
RefSeq Size | 3005 bp |
RefSeq ORF | 378 bp |
Locus ID | 25620 |
Gene Summary | Transcriptional regulator that binds the cAMP response element (CRE), a sequence present in many viral and cellular promoters. Isoforms are either transcriptional activators or repressors. Isoform Delta is an activator. Plays a role in spermatogenesis and is involved in spermatid maturation. Binding of isoform Tau (activator) to CRE is increased by CREB3L4. The CREM isoform Tau-CREB3L4 heterodimer functions through CRE and may recruit HIRA to CRE to regulate histone exchange (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in both UTR's and the coding region but maintains the reading frame, compared to variant 3. This results in a protein (isoform 2) that is shorter at both the N- and C-termini, compared to isoform 3. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR200401 | Crem (Myc-DDK-tagged ORF) - Rat cAMP responsive element modulator (Crem), transcript variant 2, (10 ug) |
CNY 3,990.00 |
|
RR200401L3 | Lenti ORF clone of Crem (Myc-DDK-tagged ORF) - Rat cAMP responsive element modulator (Crem), transcript variant 2, (10 ug) |
CNY 6,080.00 |
|
RR200401L4 | Lenti ORF clone of Crem (mGFP-tagged ORF) - Rat cAMP responsive element modulator (Crem), transcript variant 2, (10 ug) |
CNY 6,650.00 |