Msrb1 (NM_013759) Mouse Tagged ORF Clone
CAT#: MR227394
- TrueORF®
Msrb1 (Myc-DDK-tagged) - Mouse selenoprotein X 1 (Sepx1), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)
ORF Plasmid: tGFP
"NM_013759" in other vectors (2)
Need custom modification / cloning service?
Get a free quote
CNY 998.00
CNY 3,705.00
Cited in 1 publication. |
CNY 300.00
Specifications
Product Data | |
Type | Mouse Untagged ORF Clone |
Synonyms | D17Wsu82; D17Wsu82e; S; SelR; SELX; Sep; Sepr; Sepx1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MR227394 representing NM_013759
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCGTTCTGCAGCTTCTTCGGAGGCGAGGTTTTCCAGAATCACTTCGAGCCAGGTGTCTACGTGTGTG CCAAGTGCAGCTATGAGCTGTTCTCCAGTCACTCGAAGTACGCACACTCATCCCCGTGGCCAGCGTTCAC TGAAACCATCCACCCAGACAGTGTGACCAAGTGCCCTGAGAAAAACCGACCAGAAGCTTTAAAGGTGTCC TGTGGCAAGTGTGGCAATGGGTTGGGCCACGAGTTCCTGAATGATGGCCCCAAGCGGGGACAATCAAGAT TCTGAATATTTAGCAGCTCACTGAAGTTCGTCCCTAAAGGCAAAGAAGCTGCTGCCTCCCAGGGGCAC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI Cloning Scheme for this gene Plasmid Map |
ACCN | NM_013759 |
OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info The expression of this clone is not guaranteed due to the nature of selenoproteins. |
OTI Annotation | This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_013759.3 |
RefSeq Size | 904 bp |
RefSeq ORF | 351 bp |
Locus ID | 27361 |
UniProt ID | Q9JLC3 |
Gene Summary | The protein encoded by this gene belongs to the methionine-R-sulfoxide reductase B (MsrB) family. Members of this family function as repair enzymes that protect proteins from oxidative stress by catalyzing the reduction of methionine-R-sulfoxides to methionines. This protein is highly expressed in liver and kidney, and is localized to the nucleus and cytosol. It is the only member of the MsrB family that is a selenoprotein, containing a selenocysteine (Sec) residue at its active site. It also has the highest methionine-R-sulfoxide reductase activity compared to other members containing cysteine in place of Sec. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2016] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Mapping axon initial segment structure and function by multiplexed proximity biotinylation
,Hamdan, H;Lim, BC;Torii, T;Joshi, A;Konning, M;Smith, C;Palmer, DJ;Ng, P;Leterrier, C;Oses-Prieto, JA;Burlingame, AL;Rasband, MN;,
Nat Commun
,PubMed ID 31900387
[MSRB1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC209780 | Msrb1 (untagged) - Mouse selenoprotein X 1 (Sepx1), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
CNY 3,990.00 |
|
MG227394 | Msrb1 (GFP-tagged) - Mouse selenoprotein X 1 (Sepx1), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
CNY 2,850.00 |