Fst (NM_008046) Mouse Tagged ORF Clone

CAT#: MR225488

  • TrueORF®

Fst (Myc-DDK-tagged) - Mouse follistatin (Fst)

ORF Plasmid: DDK tGFP



  "NM_008046" in other vectors (4)

Need custom modification / cloning service?
Get a free quote

Mouse Protein / Lysate Request

CNY 3,656.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
pCMV6-Entry, mammalian vector with C-terminal Myc- DDK Tag, 10ug
    • 10 ug

CNY 5,420.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


DDK Rabbit monoclonal antibody, recognizing both N- and C-terminal tags
    • 30 ul

CNY 300.00

Specifications

Product Data
Type Mouse Tagged ORF Clone
Tag Myc-DDK
Synonyms AL033346; D2Mgi5; FS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MR225488 representing NM_008046
Red=Cloning site Blue=ORF Green=Tags(s)

CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTCTGCGCCAGGCACCAGCCCGGCGGGCTCTGCCTCCTGCTGCTGCTACTCTGCCAGTTCATGGAGG
ACCGCAGCGCCCAGGCTGGGAATTGCTGGCTCCGCCAAGCAAAGAACGGCCGCTGCCAGGTCCTGTATAA
GACAGAACTGAGCAAGGAAGAGTGTTGCAGCACCGGCCGGCTGAGCACCTCATGGACCGAGGAGGATGTG
AACGACAATACTCTCTTCAAGTGGATGATTTTCAACGGGGGCGCCCCCAACTGCATCCCTTGTAAAGAAA
CGTGTGAGAACGTGGACTGCGGACCTGGGAAAAAATGTCGAATGAACAAGAAGAATAAACCCCGCTGCGT
CTGTGCCCCAGACTGTTCCAACATCACCTGGAAGGGCCCAGTGTGTGGGCTGGATGGGAAAACCTACCGC
AACGAATGTGCACTCCTCAAGGCCAGATGCAAAGAGCAGCCGGAACTAGAAGTACAGTACCAGGGCAAAT
GTAAAAAGACTTGTAGGGATGTTTTTTGTCCAGGCAGCTCCACTTGTGTGGTGGATCAGACCAATAATGC
CTACTGTGTGACCTGTAATCGGATTTGCCCAGAGCCCTCCTCTTCTGAACAGTACCTTTGTGGAAATGAT
GGAGTGACTTACTCCAGCGCCTGCCACCTGAGAAAGGCCACCTGCTTGCTGGGCAGATCCATTGGATTAG
CCTATGAGGGAAAGTGTATCAAAGCAAAGTCCTGTGAAGATATCCAGTGTGGCGGCGGGAAAAAATGCCT
ATGGGATTCCAAGGTTGGCAGAGGTCGCTGCTCTCTCTGCGATGAGCTGTGTCCTGACAGTAAGTCGGAT
GAGCCGGTCTGTGCCAGTGACAATGCCACATACGCCAGCGAGTGTGCCATGAAGGAAGCTGCCTGCTCTT
CTGGCGTGCTTCTTGAAGTGAAGCATTCTGGATCTTGCAACTCCATCTCGGAAGAAACGGAGGAAGAGGA
GGAGGAGGAAGACCAGGACTACAGCTTTCCTATCTCTTCCATTCTAGAGTGG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI      Cloning Scheme for this gene      Plasmid Map     
ACCN NM_008046
ORF Size 1032 bp
OTI Disclaimer The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_008046.1, NM_008046.2, NM_008046.3, NP_032072.1
RefSeq Size 2337 bp
RefSeq ORF 1032 bp
Locus ID 14313
UniProt ID P47931
MW 38.2 kDa
Gene Summary The protein encoded by this gene binds to and negatively regulates activin, as well as other members of the transforming growth factor beta family, and acts to prevent uncontrolled cellular proliferation. This protein also contains a heparin-binding sequence. It is expressed in many of the tissues in which activin is synthesized and is thought to clear activin from the circulation by attachment to the cell surface. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms, including FST315 and FST288, that differ at their C-terminus. Another isoform, FST303 is thought to be produced by proteolytic cleavage of FST315. These isoforms differ in their localization and in their ability to bind heparin. While FST315 is a circulating protein, FST288 is tissue-bound, and FST303 is gonad-specific. While deletion of all isoforms results in embryonic lethality, expression of just FST288 is sufficient for embryonic development, but the resultant mice have fertility defects. [provided by RefSeq, Aug 2014]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...