Rps23 (NM_024175) Mouse Tagged ORF Clone
CAT#: MR216204
- TrueORF®
Rps23 (Myc-DDK-tagged) - Mouse ribosomal protein S23 (Rps23)
ORF Plasmid: tGFP
"NM_024175" in other vectors (4)
Need custom modification / cloning service?
Get a free quote
CNY 1,200.00
CNY 3,705.00
CNY 300.00
Specifications
Product Data | |
Type | Mouse Tagged ORF Clone |
Tag | Myc-DDK |
Synonyms | 2410044J15Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MR216204 representing NM_024175
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGCAAGTGTCGTGGTCTCCGAACTGCCCGGAAGCTCCGCAGTCACCGACGGGACCAGAAGTGGCATG ACAAACAGTACAAGAAGGCCCACTTGGGCACAGCCCTGAAGGCCAATCCGTTTGGGGGTGCCTCTCATGC AAAGGGAATTGTGCTGGAAAAAGTAGGGGTTGAGGCCAAACAGCCAAATTCTGCCATCAGGAAGTGCGTC AGGGTGCAGCTCATTAAGAACGGGGAGAAGATCACAGCGTTCGTGCCCAATGATGGCTGCCTGAACTTCA TTGAGGAAAATGATGAAGTTCTGGTTGCTGGATTTGGTCGAAAAGGTCATGCTGTAGGTGATATTCCTGG AGTCCGCTTTAAGGTGGTTAAAGTAGCCAATGTTTCTCTGTTGGCTCTATACAAAGGCAAGAAAGAAAGG CCAAGATCA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites |
SgfI-MluI
Cloning Scheme for this gene
Plasmid Map
![]() |
ACCN | NM_024175 |
ORF Size | 429 bp |
OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_024175.1, NM_024175.2, NM_024175.3, NP_077137.1 |
RefSeq Size | 572 bp |
RefSeq ORF | 432 bp |
Locus ID | 66475 |
UniProt ID | P62267 |
MW | 16.3 kDa |
Gene Summary | Component of the ribosome, a large ribonucleoprotein complex responsible for the synthesis of proteins in the cell. The small ribosomal subunit (SSU) binds messenger RNAs (mRNAs) and translates the encoded message by selecting cognate aminoacyl-transfer RNA (tRNA) molecules. The large subunit (LSU) contains the ribosomal catalytic site termed the peptidyl transferase center (PTC), which catalyzes the formation of peptide bonds, thereby polymerizing the amino acids delivered by tRNAs into a polypeptide chain. The nascent polypeptides leave the ribosome through a tunnel in the LSU and interact with protein factors that function in enzymatic processing, targeting, and the membrane insertion of nascent chains at the exit of the ribosomal tunnel. Plays an important role in translational accuracy.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC210375 | Rps23 (untagged) - Mouse ribosomal protein S23 (Rps23), (10ug) |
CNY 3,990.00 |
|
MG216204 | Rps23 (tGFP-tagged) - Mouse ribosomal protein S23 (Rps23), (10ug) |
CNY 2,850.00 |
|
MR216204L3 | Lenti ORF clone of Rps23 (Myc-DDK-tagged) - Mouse ribosomal protein S23 (Rps23) |
CNY 4,750.00 |
|
MR216204L4 | Lenti ORF clone of Rps23 (mGFP-tagged) - Mouse ribosomal protein S23 (Rps23) |
CNY 4,750.00 |