Foxp1 (NM_001197322) Mouse Untagged Clone

CAT#: MC228355

Foxp1 (untagged) - Mouse forkhead box P1 (Foxp1), transcript variant 3



  "NM_001197322" in other vectors (1)

CNY 5,610.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 3110052D19Rik; 4932443N09Rik; AI461938; AW494214
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC228355 representing NM_001197322
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGACACCTCAGGTTATCACTCCTCAACAAATGCAGCAGATCCTCCAGCAGCAGGTGCTGAGCCCCC
AGCAGCTCCAGGTTCTCCTCCAGCAGCAGCAGGCCCTCATGCTTCAACAGCAGCTTCAAGAATTTTATAA
AAAACAACAGGAACAGTTGCAGCTTCAACTTCTCCAACAGCAACATGCTGGAAAACAGCCGAAAGAGCAG
CAGCAGGTGGCTACCCAGCAGTTGGCTTTCCAGCAGCAGCTTCTCCAGATGCAGCAGCTGCAGCAGCAGC
ACCTCTTGTCTCTCCAGCGCCAAGGCCTCCTAACAATTCAGCCGGGGCAGCCTGCCCTTCCCCTCCAACC
CCTCGCTCAAGGCATGATTCCAACGGAACTGCAGCAGCTCTGGAAAGAAGTGACAAGTGCCCACACTGCA
GAGGAAACCACAAGCAGCAACCACAGCAGCCTAGACCTGACCAGCACATGTGTCTCGTCCTCGGCACCTT
CCAAGTCCTCCCTAATCATGAACCCGCATGCCTCTACCAATGGACAGCTCTCGGTCCACACTCCCAAAAG
GGAAAGCTTGTCCCACGAGGAGCACCCCCACAGCCACCCTCTCTATGGACATGGCGTATGCAAGTGGCCA
GGCTGTGAGGCGGTTTGTGACGACTTCCCAGCCTTTCTAAAACATCTCAACAGTGAGCATGCGCTGGACG
ATAGAAGCACAGCTCAATGTAGAGTACAAATGCAGGTTGTACAGCAGTTAGAGCTACAGCTTGCAAAAGA
CAAAGAGCGCCTGCAAGCCATGATGACCCACCTGCATGTGAAGTCTACAGAACCCAAAGCTGCCCCTCAG
CCCCTGAATCTGGTATCAAGTGTCACCCTCTCCAAGTCTGCCTCAGAGGCTTCTCCACAGAGCTTACCTC
ATACTCCAACAACCCCCACCGCCCCCCTGACTCCTGTCACCCAAGGCCCCTCCGTCATCACCACCACCAG
CATGCACACGGTGGGACCTATCCGCAGGCGGTACTCAGACAAATACAACGTGCCCATTTCTTCAGCAGAT
ATTGCGCAGAACCAAGAATTTTATAAGAACGCGGAAGTTAGACCACCATTTACATATGCATCTTTAATCA
GGCAGGCCATTCTCGAATCTCCAGAAAAGCAGCTAACACTAAACGAAATCTATAACTGGTTCACACGAAT
GTTTGCTTACTTCCGACGCAATGCAGCCACGTGGAAGAATGCAGTGCGTCATAATCTTAGTCTCCACAAG
TGTTTTGTGCGAGTAGAGAACGTTAAAGGGGCAGTATGGACAGTGGATGAAGTAGAGTTCCAAAAACGGA
GGCCACAAAAGATCAGTGGTAACCCTTCCCTTATTAAAAACATGCAGAGCAGCCACGCCTACTGCACACC
TCTCAATGCAGCTTTACAGGCTTCCATGGCTGAGAATAGTATACCTCTGTACACTACCGCTTCCATGGGA
AATCCCACTCTGGGCAGCCTGGCCAGTGCCATCCGGGAGGAGCTGAACGGGGCCATGGAGCACACCAACA
GCAACGAGAGTGACAGCAGTCCAGGCAGATCCCCTATGCAAGCTGTGCACCCCATACACGTCAAAGAAGA
ACCCCTCGACCCCGAGGAAGCTGAAGGCCCTCTGTCCTTAGTGACAACAGCCAACCACAGTCCAGATTTT
GACCATGACAGAGATTACGAAGACGAACCAGTAAATGAGGACATGGAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001197322
Insert Size 1731 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001197322.1, NP_001184251.1
RefSeq Size 6649 bp
RefSeq ORF 1731 bp
Locus ID 108655
UniProt ID P58462
Gene Summary Transcriptional repressor. Can act with CTBP1 to synergistically repress transcription but CTPBP1 is not essential (PubMed:11358962, PubMed:14701752). Plays an important role in the specification and differentiation of lung epithelium. Acts cooperatively with FOXP4 to regulate lung secretory epithelial cell fate and regeneration by restricting the goblet cell lineage program; the function may involve regulation of AGR2 (PubMed:11358962, PubMed:22675208). Essential transcriptional regulator of B-cell development (PubMed:16819554). Involved in regulation of cardiac muscle cell proliferation (PubMed:20713518). Involved in the columnar organization of spinal motor neurons. Promotes the formation of the lateral motor neuron column (LMC) and the preganglionic motor column (PGC) and is required for respective appropriate motor axon projections. The segment-appropriate generation of spinal chord motor columns requires cooperation with other Hox proteins (PubMed:18667151, PubMed:18662545). Can regulate PITX3 promoter activity; may promote midbrain identity in embryonic stem cell-derived dopamine neurons by regulating PITX3 (PubMed:20175877). Negatively regulates the differentiation of T follicular helper cells T(FH)s (PubMed:24859450). Involved in maintenance of hair follicle stem cell quiescence; the function probably involves regulation of FGF18 (PubMed:23946441). Represses transcription of various pro-apoptotic genes and cooperates with NF-kappa B-signaling in promoting B-cell expansion by inhibition of caspase-dependent apoptosis. Binds to CSF1R promoter elements and is involved in regulation of monocyte differentiation and macrophage functions; repression of CSF1R in monocytes seems to involve NCOR2 as corepressor. Involved in endothelial cell proliferation, tube formation and migration indicative for a role in angiogenesis; the role in neovascularization seems to implicate suppression of SEMA5B. Can negatively regulate androgen receptor signaling (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (3) is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...