Pip5k1c (NM_001293647) Mouse Untagged Clone

CAT#: MC228296

Pip5k1c (untagged) - Mouse phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma (Pip5k1c), transcript variant 4



  "NM_001293647" in other vectors (1)

CNY 5,420.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI115456; AI835305; Pip5kIgamma
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC228296 representing NM_001293647
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGGACTTCTACGTGGTGGAGAGCATCTTCTTCCCCAGTGAAGGGAGCAACCTCACCCCTGCCCACC
ACTTCCAGGATTTCCGCTTCAAGACCTATGCACCTGTTGCCTTCCGCTACTTCCGGGAGCTCTTTGGCAT
CCGTCCAGATGACTATTTGTACTCCCTGTGCAATGAGCCACTCATCGAGCTCTCCAACCCCGGGGCCAGC
GGCTCTGTCTTCTACGTCACCAGCGACGACGAGTTCATCATCAAGACTGTCATGCACAAGGAGGCAGAGT
TCCTGCAGAAGCTGCTGCCTGGCTACTACATGAATCTCAACCAGAACCCACGGACGCTGCTGCCCAAGTT
CTATGGGCTGTACTGCGTGCAGTCTGGTGGCAAGAACATCCGCGTGGTGGTCATGAACAATGTGCTGCCC
CGTGTCGTCAAAATGCACCTTAAGTTCGACCTCAAGGGCTCCACGTACAAGCGCAGGGCCAGCAAGAAGG
AGAAGGAGAAGAGCCTGCCCACCTACAAGGACCTGGACTTCATGCAGGACATGCCCGAGGGGCTGCTGCT
GGACTCCGACACCTTTGGCGCCCTGGTCAAGACGCTGCAGCGAGACTGCCTGGTGCTGGAGAGCTTCAAG
ATAATGGACTACAGCCTGCTGCTGGGCGTGCACAACATCGATCAGCAGGAGCGAGAGCGCCAGGCCGAGG
GCGCCCAGAGCAAGGCGGATGAGAAGCGGCCCGTGGCCCAGAAGGCTCTGTATTCCACGGCCATGGAGTC
TATCCAGGGCGGAGCTGCCCGTGGGGAGGCCATTGAGACAGATGACACGATGGGTGGGATTCCAGCAGTG
AATGGGCGCGGGGAGCGACTGCTCCTCCACATCGGGATCATTGATATTCTGCAGTCCTACAGGTTCATCA
AGAAGTTAGAACACACCTGGAAGGCCCTCGTCCATGATGGGGACACTGTCTCAGTCCACCGGCCCAGCTT
CTATGCAGAGCGCTTCTTCAAGTTCATGAGCAGCACGGTGTTCCGGAAGAGTTCCTCCCTGAAGTCCTCT
CCATCCAAGAAAGGACGTGGTGCCCTGCTGGCGGTCAAACCCCTGGGGCCCACTGCTGCCTTCTCAGCCA
GCCAGATCCCCAGCGAGAGAGAGGATGTGCAGTATGACCTGCGGGGGGCCCGCAGCTACCCCACGCTTGA
GGATGAAGGCCGGCCTGACCTCCTGCCCTGCACCCCACCGTCCTTTGAGGAAGCCACCACAGCCTCCATC
GCCACCACCCTGTCGTCCACCTCCCTCTCCATCCCAGAGCGGTCCCCTTCAGATACATCGGAGCAGCCCC
GGTACAGGCGGCGCACGCAGTCTTCAGGCCAGGATGGCCGGCCCCAGGAGGAGCCCCATGCGGAAGACCT
GCAGAAGATAACTGTGCAGGTGGAGCCAGTGTGCGGTGTGGGGGTTGTCCCCAAGGAGGAGGGTGCAGGA
GTGGAGGTCCCCCCATGTGGGGCATCGGCTGCAGCCTCTGTGGAAATAGACGCTGCCAGCCAGGCCTCAG
AGCCTGCCAGCCAGGCCTCAGATGAGGAGGATGCACCCTCTACAGACATCTATTTTCCCACCGACGAGAG
GAGCTGGGTGTACTCCCCGCTTCACTATAGCGCGCGGCCCGCCTCCGACGGCGAGAGCGACACATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001293647
Insert Size 1677 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001293647.1, NP_001280576.1
RefSeq Size 4313 bp
RefSeq ORF 1677 bp
Locus ID 18717
UniProt ID O70161
Gene Summary Catalyzes the phosphorylation of phosphatidylinositol 4-phosphate (PtdIns4P) to form phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2). PtdIns(4,5)P2 is involved in a variety of cellular processes and is the substrate to form phosphatidylinositol 3,4,5-trisphosphate (PtdIns(3,4,5)P3), another second messenger. The majority of PtdIns(4,5)P2 is thought to occur via type I phosphatidylinositol 4-phosphate 5-kinases given the abundance of PtdIns4P. Participates in a variety of cellular processes such as vesicle mediated transport, cell adhesion, cell polarization and cell migration. Together with PIP5K1A is required for phagocytosis, but they regulate different types of actin remodeling at sequential steps. Promotes particle attachment by generating the pool of PtdIns(4,5)P2 that induces controlled actin depolymerization to facilitate Fc-gamma-R clustering. Mediates RAC1-dependent reorganization of actin filaments. Required for synaptic vesicle transport. Controls the plasma membrane pool of PtdIns(4,5)P2 implicated in synaptic vesicle endocytosis and exocytosis. Plays a role in endocytosis mediated by clathrin and AP-2 (adaptor protein complex 2). Required for clathrin-coated pits assembly at the synapse. Participates in cell junction assembly. Modulates adherens junctions formation by facilitating CDH1 trafficking. Required for focal adhesion dynamics. Modulates the targeting of talins (TLN1 and TLN2) to the plasma membrane and their efficient assembly into focal adhesions. Regulates the interaction between talins (TLN1 and TLN2) and beta-integrins. Required for uropodium formation and retraction of the cell rear during directed migration. Has a role in growth factor- stimulated directional cell migration and adhesion. Required for talin assembly into nascent adhesions forming at the leading edge toward the direction of the growth factor. Negative regulator of T-cell activation and adhesion. Negatively regulates integrin alpha-L/beta-2 (LFA-1) polarization and adhesion induced by T-cell receptor. Together with PIP5K1A has a role during embryogenesis and together with PIP5K1B may have a role immediately after birth.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' and 3' coding region, and initiates translation at a downstream start codon, compared to variant 3. The encoded protein (isoform 4) is shorter, compared to isoform 3.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...