Slc26a5 (NM_001289788) Mouse Untagged Clone

CAT#: MC227903

Slc26a5 (untagged) - Mouse solute carrier family 26, member 5 (Slc26a5), transcript variant 3



  "NM_001289788" in other vectors (1)

CNY 4,560.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Pres; prestin
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227903 representing NM_001289788
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTTTTTGGTTTGCTGTTGGGTGGCAAGGAATTTAATGAGAGATTTAAAGAGAAATTGCCAGCACCCA
TTCCTCTAGAGTTCTTTGCTGTGGTGATGGGGACTGGCATTTCTGCAGGATTTAACCTACATGAGTCCTA
CAGTGTGGATGTCGTTGGAACACTTCCTCTGGGGCTACTTCCTCCGGCCAACCCAGACACCAGCCTGTTC
CACCTGGTGTATGTGGACGCCATTGCCATCGCCATCGTTGGATTTTCAGTGACGATCTCCATGGCCAAAA
CCTTGGCAAATAAGCATGGCTACCAGGTTGATGGCAATCAGGAGCTCATTGCCTTGGGGATATGCAACTC
CATTGGATCTCTCTTCCAAACCTTCTCGATTTCCTGCTCCTTGTCTCGAAGCCTTGTTCAGGAAGGAACT
GGAGGGAAAACACAGCTTGCAGGTTGTTTGGCCTCGTTGATGATTCTGTTGGTCATATTAGCCACCGGAT
TCCTCTTTGAGTCGTTACCCCAGGCTGTCCTTTCCGCCATTGTGATCGTCAACCTGAAAGGAATGTTCAT
GCAGTTCTCAGACCTGCCTTTTTTCTGGAGAACCAGCAAAATAGAGCTGACCATCTGGCTGACCACCTTT
GTGTCCTCCCTGTTCCTCGGCTTGGACTACGGACTGATTACCGCCGTGATCATTGCTCTGCTCACAGTGA
TTTATAGAACACAGAGTCCAAGCTACAAAGTCCTGGGGCAGCTCCCTGACACGGATGTGTACATTGACAT
AGATGCATATGAGGAGGTGAAAGAAATTCCTGGAATAAAAATATTCCAAATAAATGCCCCAATTTACTAT
GCAAATAGCGACTTGTATAGCAGCGCTTTAAAAAGAAAGACTGGAGTAAACCCAGCACTCATTATGGGAG
CGAGAAGAAAGGCCATGAGGAAGTACGCCAAGGAAGTTGGAAATGCCAACGTGGCCAATGCTACTGTTGT
CAAAGTGGATGCAGAAGTAGACGGAGAAAATGCTACAAAACCTGAAGAAGAGGATGATGAAGTCAAATTT
CCCCCAATAGTCATCAAAACAACATTTCCTGAAGAGCTGCAGAGATTTTTGCCCCAGGGGGAAAATGTCC
ACACTGTCATTCTAGACTTTACGCAGGTCAATTTTGTGGATTCTGTTGGAGTGAAAACTCTGGCCGGGAT
TGTGAAAGAATATGGAGATGTTGGAATTTATGTATATTTAGCAGGATGCAGCCCACAAGTTGTGAATGAC
CTCACCCGCAACAACTTTTTTGAAAATCCTGCCTTGAAAGAGCTTCTGTTCCACAGTATCCACGATGCAG
TCCTGGGCAGCCAAGTTCGGGAGGCAATGGCTGAACAAGAAGCCACAGCGTCACTTCCCCAGGAGGATAT
GGAGCCCAATGCCACACCCACCACCCCCGAGGCATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289788
Insert Size 1437 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001289788.1, NP_001276717.1
RefSeq Size 4378 bp
RefSeq ORF 1437 bp
Locus ID 80979
UniProt ID Q99NH7
Gene Summary Motor protein that converts auditory stimuli to length changes in outer hair cells and mediates sound amplification in the mammalian hearing organ. Prestin is a bidirectional voltage-to-force converter, it can operate at microsecond rates. It uses cytoplasmic anions as extrinsic voltage sensors, probably chloride and bicarbonate. After binding to a site with millimolar affinity, these anions are translocated across the membrane in response to changes in the transmembrane voltage. They move towards the extracellular surface following hyperpolarization, and towards the cytoplasmic side in response to depolarization. As a consequence, this translocation triggers conformational changes in the protein that ultimately alter its surface area in the plane of the plasma membrane. The area decreases when the anion is near the cytoplasmic face of the membrane (short state), and increases when the ion has crossed the membrane to the outer surface (long state). So, it acts as an incomplete transporter. It swings anions across the membrane, but does not allow these anions to dissociate and escape to the extracellular space. Salicylate, an inhibitor of outer hair cell motility, acts as competitive antagonist at the prestin anion-binding site (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream start codon, compared to variant 1. It encodes isoform 3, which is shorter at the N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...