Terf2 (NM_001286200) Mouse Untagged Clone

CAT#: MC227889

Terf2 (untagged) - Mouse telomeric repeat binding factor 2 (Terf2), transcript variant 3



  "NM_001286200" in other vectors (1)

CNY 4,560.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms TRF2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227889 representing NM_001286200
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGCGGGAGCCGGGACAGCGGGCCCTGCTTCCGGCCCGGGCGTTGTGCGTGACCCGATGGCGTCAC
AGCCAAGGAAACGGCCCAGTCGGGAGGGCGGGGAGGGCGGGGAGGGCGAGCGGCGGTCGAACACGATGGC
GGGAGGAGGCGGGAGCAGCGATAGCAGCGGGCGGGCGGCGAGCCGACGGGCATCGCGCAGCGGCGGGCGG
GCTCGACGGGGGCGACACGAGCCAGGGTTGGGAGGCGCGGCCGAGCGGGGCGCGGGGGAAGCTCGCCTGG
AGGAGGCGGTCAACCGCTGGGTGCTCAAGTTCTATTTCCACGAGGCGCTGCGGGCCTTTCGGAGTAGCCG
GTACCGGGACTTCAGGCAGATCCGGGACATCATGCAGGCGTTGCTTGTCAGGCCCTTGGGGAAGGAGCAT
ACGGTGTCCCGGTTGCTGCGGGTTATGCAGTGTCTGTCGCGCATTGAAGAAGGAGAAAATTTAGACTGTT
CCTTTGATATGGAGGCTGAGCTCACACCCTTGGAATCAGCTATCAATGTGCTGGAGATGATTAAAACAGA
GTTCACACTGACAGACTCTATGGTTGAATCCAGCAGAAAACTGGTCAAGGAGGCTGCTGTCATTATTTGT
ATCAAAAACAAAGAATTTGAAAAGGCTTCAAAGATTTTGAAAAAATACATGTCTAAGGACCCCACAACTC
AGAAGCTGAGAACTGATCTCCTGAACATTATCCGGGAAAAGAACTTGGCCCACCCTGTTATCCAGAACTT
TTCCTATGAGGTCTTCCAGCAGAAGATGCTGCGTTTCCTAGAGAGCCACCTGGATGACACGGAGCCCTAC
CTCCTCACGATGGCTAAAAAAGCTTTGAAATCTGAATCAGCTGCTTCAAGTACAATGAGGGAAGAAAAGC
ACCCAGAGCCAGTGGAAAAACCACTTAGAGAGCCTCCAAGACAGCCTCAGAACCCTCCAGCCACCATCGG
GATCAGGACTCTGAAGGCAGCTTTCAAAGCTCTGTCTACTGCACAAGACTCAGAGGCCGCTTTTGCAAAA
CTGGACCAGAAAGATCTGGCTGGGACGTGTATGTTCATGTATGAAGATGCCTGGAAAACTGACAGCGAGT
TTGAACATTGTGTAGTGAATCCCAAAGCATCCAAAGACAAGTGGAACAGCCCTAACGGGCTTGAAGAAAA
GGAAGTTTGGTTGGAAGAGGACCAGCTGTTTGAAGTTCAGGCACCAGGTGAAGACAGGTCATCCAGTTTA
ACAAGAAAGCAGAAGTGGACCATAGAAGAAAGCGAGTGGGTGAAGGATGGAGTGCGCAAATACGGGGAAG
GAAACTGGGCTGCCATTTCTAAAAGTTACCCCTTTGTCAACCGAACAGCTGTGATGATTAAAGACCGCTG
GCGGACCATGAAAAAACTTGGCATGAACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001286200
Insert Size 1431 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286200.1, NP_001273129.1
RefSeq Size 2472 bp
RefSeq ORF 1431 bp
Locus ID 21750
UniProt ID O35144
Gene Summary Binds the telomeric double-stranded 5'-TTAGGG-3' repeat and plays a central role in telomere maintenance and protection against end-to-end fusion of chromosomes. In addition to its telomeric DNA-binding role, required to recruit a number of factors and enzymes required for telomere protection, including the shelterin complex, TERF2IP/RAP1 and DCLRE1B/Apollo. Component of the shelterin complex (telosome) that is involved in the regulation of telomere length and protection. Shelterin associates with arrays of double-stranded 5'-TTAGGG-3' repeats added by telomerase and protects chromosome ends; without its protective activity, telomeres are no longer hidden from the DNA damage surveillance and chromosome ends are inappropriately processed by DNA repair pathways. Together with DCLRE1B/Apollo, plays a key role in telomeric loop (T loop) formation by generating 3' single-stranded overhang at the leading end telomeres: T loops have been proposed to protect chromosome ends from degradation and repair. Required both to recruit DCLRE1B/Apollo to telomeres and activate the exonuclease activity of DCLRE1B/Apollo. Preferentially binds to positive supercoiled DNA. Together with DCLRE1B/Apollo, required to control the amount of DNA topoisomerase (TOP1, TOP2A and TOP2B) needed for telomere replication during fork passage and prevent aberrant telomere topology. Recruits TERF2IP/RAP1 to telomeres, thereby participating in to repressing homology-directed repair (HDR), which can affect telomere length.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) uses an alternate in-frame splice site and contains an alternate exon in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 3), compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...