Hnrnpk (NM_001301343) Mouse Untagged Clone

CAT#: MC227833

Hnrnpk (untagged) - Mouse heterogeneous nuclear ribonucleoprotein K (Hnrnpk), transcript variant 3



  "NM_001301343" in other vectors (1)

CNY 4,470.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
HNRNPK Antibody - middle region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms hn; Hnrpk; KBB; KBBP; NOVA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001301343, the custom clone sequence may differ by one or more nucleotides


ATGGAGACCGAACAGCCAGAAGAAACCTTCCCCAACACCGAAACCAATGGTGAATTTGGTAAACGCCCTG
CAGAAGATATGGAAGAGGAGCAAGCCTTTAAAAGATCTAGAAATACTGATGAGATGGTTGAATTGCGCAT
TTTGCTTCAGAGCAAGAATGCTGGAGCAGTGATTGGAAAAGGAGGCAAGAATATTAAGGCTCTCCGTACA
GACTACAATGCCAGTGTTTCAGTCCCAGACAGCAGTGGCCCCGAGCGCATACTGAGTATCAGTGCTGATA
TTGAGACGATTGGAGAAATTCTGAAGAAAATCATCCCTACCTTGGAAGAGGGCCTGCAGTTGCCATCACC
CACTGCAACCAGCCAGCTCCCGCTCGAATCTGATGCTGTGGAATGCTTAAATTACCAACATTATAAAGGA
AGTGACTTTGATTGCGAGTTGAGACTGTTGATTCATCAGAGTCTGGCAGGAGGAATAATTGGTGTTAAAG
GTGCTAAAATCAAAGAACTTCGAGAAAACACTCAGACAACAATCAAGCTTTTCCAGGAGTGCTGCCCTCA
CTCTACTGACAGAGTTGTTCTTATTGGAGGAAAACCTGATAGGGTTGTAGAATGCATCAAGATCATCCTT
GACCTTATATCTGAGTCTCCCATCAAAGGACGTGCACAACCTTATGATCCCAACTTTTATGATGAGACCT
ATGATTATGGTGGTTTTACAATGATGTTTGATGACCGCCGAGGACGACCTGTGGGATTCCCCATGAGGGG
AAGAGGTGGTTTTGACAGAATGCCTCCTGGTCGGGGTGGGCGTCCCATGCCTCCTTCTAGAAGAGATTAT
GATGATATGAGCCCTCGTCGAGGACCTCCACCACCACCACCTGGTCGAGGTGGCCGGGGTGGCAGCAGAG
CCCGGAATCTGCCTCTTCCTCCTCCACCACCACCCAGAGGGGGAGATCTAATGGCTTATGACAGAAGAGG
AAGGCCTGGAGACCGCTATGATGGCATGGTTGGGTTCAGTGCTGATGAAACTTGGGATTCTGCAATTGAC
ACATGGAGCCCATCAGAATGGCAAATGGCTTATGAACCACAGGGTGGTTCTGGATATGACTATTCTTATG
CAGGGGGCCGTGGCTCATATGGTGATCTTGGCGGACCTATTATCACTACACAAGTAACTATTCCCAAAGA
TTTGGCTGGATCTATTATTGGCAAAGGTGGTCAGCGGATTAAACAAATTCGTCATGAATCTGGAGCATCA
ATCAAAATTGATGAACCTTTAGAAGGATCTGAAGATCGGATCATTACCATTACAGGAACACAGGACCAGA
TACAGAACGCACAGTATTTGCTGCAGAACAGTGTGAAGCAGTATGCAGATGTTGAAGGATTCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001301343
Insert Size 1395 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001301343.1, NP_001288272.1
RefSeq Size 2839 bp
RefSeq ORF 1395 bp
Locus ID 15387
UniProt ID P61979
Gene Summary The protein encoded by this gene is a component of the heterogeneous nuclear ribonucleoprotein (hnRNP) complex, and is a poly-cytosine binding protein (PCBP). It is found in multiple subcellular compartments including the nucleus, cytoplasm and mitochondria. This gene product is thought to interact with RNA, DNA, and protein, and is involved in multiple cellular processes, including transcription, chromatin remodeling, DNA damage response, signal transduction, mRNA splicing, export, and translation. Multiple transcript variants and protein isoforms exist, with some isoforms containing a unique C-terminus. There are four pseudogenes of this gene, found on chromosomes 2, 3, 7 and 13. [provided by RefSeq, Aug 2014]
Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...