Kat5 (NM_001199247) Mouse Untagged Clone

CAT#: MC227819

Kat5 (untagged) - Mouse K(lysine) acetyltransferase 5 (Kat5), transcript variant 2



  "NM_001199247" in other vectors (1)

CNY 4,470.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Kat5 Antibody - N-terminal region
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI839539; CPLA2; Htatip; Htatip1; PLIP; Tip55; Tip60
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227819 representing NM_001199247
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGAGGTGGGGGAGATAATCGAGGGCTGCCGCCTGCCCGTGCTGCGGCGCAACCAGGACAACGAAG
ATGAGTGGCCCCTGGCTGAGATCCTGAGCGTGAAGGACATCAGTGGCCGAAAGCTTTTCTATGTCCATTA
CATTGACTTCAACAAACGTCTGGATGAATGGGTGACTCACGAGCGGCTGGACTTAAAGAAGATCCAATTT
CCCAAGAAAGAGGCCAAGACACCTACCAAGAACGGACTTCCTGGGTCCCGCCCCGGCTCTCCCGAAAGAG
AGGTGAAACGGAAGGTGGAGGTGGTTTCACCAGCAACCCCAGTGCCCAGCGAGACAGCCCCAGCCTCGGT
TTTCCCTCAGAATGGGTCAGCCCGTAGGGCAGTGGCAGCCCAGCCTGGACGGAAGCGGAAATCTAATTGC
TTGGGCACTGATGAGGATTCTCAGGACAGCTCAGATGGAATACCGTCAGCACCACGAATGACTGGCAGTC
TGGTGTCTGACCGGAGCCACGACGACATTGTCACCCGGATGAAGAACATTGAGTGTATTGAGCTTGGCCG
GCACCGCCTCAAGCCGTGGTACTTCTCCCCGTACCCACAAGAGCTTACCACGCTACCCGTCCTCTACCTG
TGCGAATTTTGCCTCAAATATGGCCGTAGCCTCAAGTGTCTGCAACGCCACTTGACCAAATGTGATCTTC
GGCACCCTCCAGGCAATGAAATTTACCGCAAGGGCACCATCTCCTTTTTTGAGATTGATGGACGGAAAAA
CAAGAGTTACTCACAAAACCTGTGTCTTCTGGCCAAGTGTTTCCTGGACCACAAAACACTGTACTATGAC
ACTGACCCCTTCCTCTTCTACGTAATGACGGAGTATGACTGCAAAGGTTTCCACATCGTGGGCTACTTCT
CCAAGGAAAAGGAATCCACAGAAGATTACAATGTGGCCTGCATCTTGACTCTGCCTCCCTACCAGCGCCG
GGGCTATGGCAAGCTGCTTATTGAGTTCAGCTATGAACTCTCGAAAGTAGAAGGGAAGACCGGAACTCCT
GAGAAACCCCTGTCAGATCTTGGCCTCCTATCCTACCGAAGTTACTGGTCCCAAACCATCTTGGAGATCC
TGATGGGGCTGAAGTCGGAGAGCGGGGAGAGGCCACAGATCACCATCAATGAGATCAGTGAAATCACTAG
TATCAAGAAAGAAGATGTCATCTCCACACTGCAGTATCTCAACCTCATCAATTACTACAAGGGCCAGTAT
ATCCTAACTCTGTCAGAAGACATCGTGGATGGGCATGAGCGGGCTATGCTCAAGCGGCTCCTTCGGATTG
ACTCCAAGTGTCTGCACTTCACTCCCAAAGACTGGAGCAAGAGAGGAAAGTGGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001199247
Insert Size 1386 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199247.1, NP_001186176.1
RefSeq Size 1872 bp
RefSeq ORF 1386 bp
Locus ID 81601
UniProt ID Q8CHK4
Gene Summary Catalytic subunit of the NuA4 histone acetyltransferase complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histones H4 and H2A (By similarity). This modification may both alter nucleosome-DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription (By similarity). This complex may be required for the activation of transcriptional programs associated with oncogene and proto-oncogene mediated growth induction, tumor suppressor mediated growth arrest and replicative senescence, apoptosis, and DNA repair (By similarity). NuA4 may also play a direct role in DNA repair when recruited to sites of DNA damage (By similarity). Component of a SWR1-like complex that specifically mediates the removal of histone H2A.Z/H2AFZ from the nucleosome (By similarity). Also acetylates non-histone proteins, such as ATM, NR1D2, RAN, FOXP3, ULK1 and RUBCNL/Pacer (PubMed:22539723). Directly acetylates and activates ATM. Relieves NR1D2-mediated inhibition of APOC3 expression by acetylating NR1D2 (By similarity). Promotes FOXP3 acetylation and positively regulates its transcriptional repressor activity. Acetylates RAN at 'Lys-134' (By similarity). Together with GSK3 (GSK3A or GSK3B), acts as a regulator of autophagy: phosphorylated at Ser-86 by GSK3 under starvation conditions, leading to activate acetyltransferase activity and promote acetylation of key autophagy regulators, such as ULK1 and RUBCNL/Pacer (PubMed:22539723).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an in-frame exon in the 5' coding region, compared to variant 1, and encodes a shorter isoform (2, also known as beta), compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...