Pacsin1 (NM_001286744) Mouse Untagged Clone

CAT#: MC227723

Pacsin1 (untagged) - Mouse protein kinase C and casein kinase substrate in neurons 1 (Pacsin1), transcript variant 4



  "NM_001286744" in other vectors (1)

CNY 4,280.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms A830061D09Rik; H74; mKIAA1379; syndapin
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227723 representing NM_001286744
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTGGCTCCTACGATGAGGCCTCAGAGGAGATCACAGATAGCTTCTGGGAGGTGGGGAACTACAAGC
GGACGGTGAAGCGCATCGACGATGGGCACCGCCTGTGCAACGACCTCATGAGCTGCGTGCAGGAGCGCGC
CAAGATCGAGAAGGCATACGCGCAGCAGCTCACCGACTGGGCCAAGCGCTGGCGCCAGCTCATCGAGAAA
GGTCCTCAGTATGGCAGCCTGGAGCGGGCGTGGGGCGCCATGATGACAGAAGCAGATAAGGTCAGCGAGC
TGCACCAGGAGGTGAAGAACAGCCTGCTGAATGAGGACCTGGAGAAAGTCAAGAACTGGCAGAAGGATGC
CTATCACAAGCAGATCATGGGTGGCTTCAAGGAGACGAAAGAGGCCGAGGATGGCTTCCGAAAGGCCCAG
AAGCCCTGGGCTAAAAAGATGAAGGAGCTAGAGGCGGCCAAGAAGGCCTATCACTTGGCTTGTAAGGAGG
AAAGGCTGGCCATGACCCGGGAGATGAACAGTAAGACAGAGCAGTCGGTCACCCCTGAACAGCAGAAGAA
ACTTGTGGACAAAGTGGACAAATGCAGACAGGATGTGCAAAAGACTCAGGAGAAGTATGAGAAGGTGCTG
GAAGATGTGGGCAAGACCACACCACAGTACATGGAGGGCATGGAGCAGGTGTTTGAGCAGTGCCAGCAGT
TTGAGGAGAAGCGGCTGGTCTTCCTGAAGGAAGTCCTGCTGGATATCAAACGGCATCTCAACCTAGCGGA
GAACAGCAGCTACATGCATGTCTACCGAGAACTGGAGCAGGCCATCCGGGGGGCCGATGCCCAGGAGGAC
CTCAGGTGGTTCCGCAGCACCAGTGGCCCCGGGATGCCCATGAACTGGCCGCAGTTCGAGGAGTGGAACC
CAGACCTCCCGCACACCACTGCCAAGAAGGAGAAACAGCCTAAGAAGGCAGAGGGGGCCACCCTGAGCAA
TGCCACTGGGGCTGTAGAATCCACATCCCAGGCTGGGGACCGTGGCAGTGTTAGCAGCTATGACCGAGGC
CAAACATATGCCACCGAGTGGTCAGACGATGAGAGCGGAAACCCCTTCGGGGGCAATGAGGCCAATGGTG
GCGCCAACCCCTTCGAGGATGATGCCAAGGGAGTTCGTGTACGGGCACTCTATGACTACGACGGTCAGGA
GCAGGATGAGCTCAGCTTCAAGGCCGGAGATGAGCTCACCAAGCTCGGAGAGGAAGACGAACAGGGTTGG
TGCCGCGGGCGGCTGGACAGCGGACAGCTGGGCCTCTATCCTGCCAACTACGTTGAGGCTATATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001286744
Insert Size 1326 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286744.1, NP_001273673.1
RefSeq Size 4156 bp
RefSeq ORF 1326 bp
Locus ID 23969
UniProt ID Q61644
Gene Summary Binds to membranes via its F-BAR domain and mediates membrane tubulation. Plays a role in the reorganization of the microtubule cytoskeleton via its interaction with MAPT; this decreases microtubule stability and inhibits MAPT-induced microtubule polymerization. Plays a role in cellular transport processes by recruiting DNM1, DNM2 and DNM3 to membranes. Plays a role in the reorganization of the actin cytoskeleton and in neuron morphogenesis via its interaction with COBL and WASL, and by recruiting COBL to the cell cortex. Plays a role in the regulation of neurite formation, neurite branching and the regulation of neurite length. Required for normal synaptic vesicle endocytosis; this process retrieves previously released neurotransmitters to accommodate multiple cycles of neurotransmission. Required for normal excitatory and inhibitory synaptic transmission.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) has an alternate splice site in the 5' UTR, compared to variant 3. All variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...