Tmem173 (NM_001289591) Mouse Untagged Clone

CAT#: MC227644

Tmem173 (untagged) - Mouse transmembrane protein 173 (Tmem173), transcript variant 2



  "NM_001289591" in other vectors (1)

CNY 3,656.00

CNY 4,090.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
STING Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2610307O08Rik; ERIS; Mita; MPYS; STING
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227644 representing NM_001289591
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATAGTAGAGAGCTTTGGGGCCTCTGGAAATCCTGTGGGGCCCTGTCACTTTTGGTCCTTGTATGGAG
TCCTGCTAGGTGTCCACTGGAGTGTGTTACATCTCGGGACCTTTAGAGGAATTCGGAGTGCGGGGCTGTG
GCTGCTGATGCCATACTCCAACCTGCATCCAGCCATCCCACGGCCCAGAGGTCACCGCTCCAAATATGTA
GCCCTCATCTTTCTGGTGGCCAGCCTGATGATCCTTTGGGTGGCAAAGGATCCACCAAATCACACTCTGA
AGTACCTAGCACTTCACCTAGCCTCGCACGAACTTGGACTACTGTTGAAAAACCTCTGCTGTCTGGCTGA
AGAGCTGTGCCATGTCCAGTCCAGGTACCAGGGCAGCTACTGGAAGGCTGTGCGCGCCTGCCTGGGATGC
CCCATCCACTGTATGGCTATGATTCTACTATCGTCTTATTTCTATTTCCTCCAAAACACTGCTGACATAT
ACCTCAGTTGGATGTTTGGCCTTCTGGTCCTCTATAAGTCCCTAAGCATGCTCCTGGGCCTTCAGAGCTT
GACTCCAGCGGAAGTCTCTGCAGTCTGTGAAGAAAAGAAGTTAAATGTTGCCCACGGGCTGGCCTGGTCA
TACTACATTGGGTACTTGCGGTTGATCTTACCAGGGCTCCAGGCCCGGATCCGAATGTTCAATCAGCTAC
ATAACAACATGCTCAGTGGTGCAGGGAGCCGAAGACTGTACATCCTCTTTCCATTGGACTGTGGGGTGCC
TGACAACCTGAGTGTAGTTGACCCCAACATTCGATTCCGAGATATGCTGCCCCAGCAAAACATCGACCGT
GCTGGCATCAAGAATCGGGTTTATTCCAACAGCGTCTACGAGATTCTGGAGAACGGACAGCCAGCAGGCG
TCTGTATCCTGGAGTACGCCACCCCCTTGCAGACCCTGTTTGCCATGTCACAGGATGCCAAAGCTGGCTT
CAGTCGGGAGGATCGGCTTGAGCAGGCTAAACTCTTCTGCCGGACACTTGAGGAAATCCTGGAAGATGTC
CCCGAGTCTCGAAATAACTGCCGCCTCATTGTCTACCAAGAACCCACAGACGGAAACAGTTTCTCACTGT
CTCAGGAGGTGCTCCGGCACATTCGTCAGGAAGAAAAGGAGGAGGTTACCATGAATGCCCCCATGACCTC
AGTGGCACCTCCTCCCTCCGTACTGTCCCAAGAGCCAAGACTCCTCATCAGTGGTATGGATCAGCCTCTC
CCACTCCGCACTGACCTCATCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_001289591
Insert Size 1284 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001289591.1, NP_001276520.1
RefSeq Size 2212 bp
RefSeq ORF 1284 bp
Locus ID 72512
UniProt ID Q3TBT3
Gene Summary Facilitator of innate immune signaling that acts as a sensor of cytosolic DNA from bacteria and viruses and promotes the production of type I interferon (IFN-alpha and IFN-beta) (PubMed:18818105, PubMed:19433799, PubMed:19776740, PubMed:26229117, PubMed:26669264). Innate immune response is triggered in response to non-CpG double-stranded DNA from viruses and bacteria delivered to the cytoplasm (PubMed:18818105, PubMed:19433799, PubMed:19776740, PubMed:26229117, PubMed:26669264). Acts by binding cyclic dinucleotides: recognizes and binds cyclic di-GMP (c-di-GMP), a second messenger produced by bacteria, and cyclic GMP-AMP (cGAMP), a messenger produced by CGAS in response to DNA virus in the cytosol (PubMed:21947006, PubMed:23722158, PubMed:23258412, PubMed:23519410, PubMed:23910378). Upon binding of c-di-GMP or cGAMP, TMEM173/STING oligomerizes, translocates from the endoplasmic reticulum and is phosphorylated by TBK1 on the pLxIS motif, leading to recruitment and subsequent activation of the transcription factor IRF3 to induce expression of type I interferon and exert a potent anti-viral state (PubMed:25636800). In addition to promote the production of type I interferons, plays a direct role in autophagy (PubMed:30568238). Following cGAMP-binding, TMEM173/STING buds from the endoplasmic reticulum into COPII vesicles, which then form the endoplasmic reticulum-Golgi intermediate compartment (ERGIC) (By similarity). The ERGIC serves as the membrane source for WIPI2 recruitment and LC3 lipidation, leading to formation of autophagosomes that target cytosolic DNA or DNA viruses for degradation by the lysosome (By similarity). The autophagy- and interferon-inducing activities can be uncoupled and autophagy induction is independent of TBK1 phosphorylation (By similarity). Autophagy is also triggered upon infection by bacteria: following c-di-GMP-binding, which is produced by live Gram-positive bacteria, promotes reticulophagy (PubMed:29056340). Exhibits 2',3' phosphodiester linkage-specific ligand recognition: can bind both 2'-3' linked cGAMP (2'-3'-cGAMP) and 3'-3' linked cGAMP but is preferentially activated by 2'-3' linked cGAMP (PubMed:26300263). The preference for 2'-3'-cGAMP, compared to other linkage isomers is probably due to the ligand itself, whichs adopts an organized free-ligand conformation that resembles the TMEM173/STING-bound conformation and pays low energy costs in changing into the active conformation (By similarity). May be involved in translocon function, the translocon possibly being able to influence the induction of type I interferons (By similarity). May be involved in transduction of apoptotic signals via its association with the major histocompatibility complex class II (MHC-II) (PubMed:18559423).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate 5' exon and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is longer than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...