Kcnj16 (NM_001252210) Mouse Untagged Clone

CAT#: MC227599

Kcnj16 (untagged) - Mouse potassium inwardly-rectifying channel, subfamily J, member 16 (Kcnj16), transcript variant 5



  "NM_001252210" in other vectors (1)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 6430410F18Rik; AI132396; Kir5.1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227599 representing NM_001252210
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCTATTACGGAAGTAGCTACAGGATCGTCAATGTGGACTCCAAATATCCAGGCTATCCTCCAGAGC
ATGCCATCGCTGAGAAGAGAAGAGCAAGAAGGCGCTTGCTCCACAAAGATGGCAGCTGTAATGTGTACTT
TAAACACATTTTTGGAGAATGGGGGAGCTACATGGTTGATATTTTTACCACTCTTGTGGATACCAAGTGG
CGCCATATGTTCGTAATATTTTCTCTGTCTTACATTCTCTCCTGGTTGATATTTGGCTCCATATTTTGGC
TCATAGCCTTTCATCACGGAGACCTATTAAGCGATCCAGATATCACCCCTTGTGTTGACAACGTGCATTC
ATTTACGGCTGCATTTTTATTCTCCCTGGAGACCCAGACCACCATTGGATACGGTTACCGCTGTGTCACC
GAAGAGTGCTCTGTGGCTGTACTGACAGTGATCCTTCAGTCCATCCTCAGCTGCATCATAAACACCTTCA
TCATTGGAGCAGCCTTGGCAAAGATGGCAACTGCCCGGAAGAGAGCCCAGACCATACGCTTCAGCTATTT
TGCCCTCATTGGTATGAGAGACGGGAAGCTTTGCCTCATGTGGCGCATAGGTGACTTCCGACCAAACCAT
GTGGTAGAGGGCACGGTGAGAGCCCAACTTCTGCGCTATTCAGAAGACAGTGAAGGGAGGATGACGATGG
CGTTTAAAGACCTCAAACTCGTCAATGACCAGATAATCCTGGTAACTCCAGTGACTATTGTCCATGAAAT
TGACCATGAGAGCCCTCTGTATGCCCTTGACCGCAAGGCAGTGGCCAAAGATAATTTCGAGATTCTGGTG
ACATTTATTTATACTGGTGATTCCACTGGGACATCCCACCAGTCCAGAAGTTCCTACATCCCCAGAGAAA
TTCTCTGGGGCCACAGGTTTCATGATGTATTGGAAGTGAAGAGAAAGTACTACAAGGTGAACTGCTTGCA
GTTTGAAGGAAGCGTGGAAGTCTACGCCCCCTTTTGCAGTGCCAAACAACTGGACTGGAAGGACCAACAA
CTCAACAACTTGGAGAAAACGTCCCCTGCCCGAGGATCCTGCAATTCTGACACCAACACCAGGAGGCGGT
CCTTCAGCGCAGTTGCCGTGGTGAGCAGCTGTGAGAACCCAGAGGAGACCGTCCTGTCCCCACAAGATGA
ATGTAAGGAGATGCCCTATCAGAAAGCCCTCCTGACTTTAAATAGGATCTCCATGGAATCCCAGATGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001252210
Insert Size 1260 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001252210.2, NP_001239139.1
RefSeq Size 3652 bp
RefSeq ORF 1260 bp
Locus ID 16517
UniProt ID Q9Z307
Gene Summary Inward rectifier potassium channels are characterized by a greater tendency to allow potassium to flow into the cell rather than out of it. Their voltage dependence is regulated by the concentration of extracellular potassium; as external potassium is raised, the voltage range of the channel opening shifts to more positive voltages. The inward rectification is mainly due to the blockage of outward current by internal magnesium. KCNJ16 may be involved in the regulation of fluid and pH balance. In the kidney, together with KCNJ10, mediates basolateral K(+) recycling in distal tubules; this process is critical for Na(+) reabsorption at the tubules.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) differs in the 5' UTR, compared to variant 1. Variants 1-5 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...