Aire (NM_001271558) Mouse Untagged Clone

CAT#: MC227534

Aire (untagged) - Mouse autoimmune regulator (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy) (Aire), transcript variant 11



  "NM_001271558" in other vectors (1)

CNY 3,900.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
AIRE Antibody - N-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227534 representing NM_001271558
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGGTGGGGATGGAATGCTACGCCGTCTGCTGAGGCTGCACCGCACCGAGATCGCGGTGGCCATAG
ACAGTGCCTTTCCGCTGCTGCATGCTCTAGCCGACCACGACGTGGTCCCTGAGGACAAGTTCCAGGAGAC
GCTCCGTCTGAAGGAGAAGGAAGGCTGCCCCCAGGCCTTCCACGCCCTGCTGTCCTGGCTCCTGACCCGG
GACAGTGGGGCCATCCTGGATTTCTGGAGGATTCTCTTTAAGGACTACAATCTGGAGCGGTACAGCCGCC
TGCATAGCATCCTGGACGGCTTCCCAAAAGATGTGGACCTAAACCAGTCCCGGAAAGGGAGAAAGCCCCT
TGCTGGTCCCAAGGCCGCGGTACTGCCACCCAGACCCCCCACCAAGAGAAAAGCACTGGAGGAGCCTCGA
GCCACCCCACCAGCAACTCTGGCCTCAAAGAGCGTCTCCAGCCCAGGCTCCCACCTGAAGACTAAGCCCC
CTAAGAAGCCAGATGGCAACTTGGAGTCACAGCACCTTCCTCTTGGAAACGGAATTCAGACCATGGCAGC
TTCTGTCCAGAGAGCTGTGACCGTGGCCTCTGGGGATGTTCCAGGAACCCGAGGGGCCGTGGAAGGGATC
CTTATCCAGCAGGTGTTTGAGTCAGGAAGATCCAAGAAGTGCATTCAGGTTGGGGGAGAGTTTTATACAC
CCAACAAGTTCGAAGACCCCAGTGGCAATTTGAAGAACAAGGCCCGGAGTGGTAGCAGCCTAAAGCCAGT
GGTCCGAGCCAAGGGAGCCCAGGGTAGAGATGAGCAGAAAGTGGGCCAGCAGTGTGGGGTTCCTCCCCTT
CCATCCCTCCCCAGTGAGCCCCAGGTTAACCAGAAGAACGAGGATGAGTGTGCCGTGTGCCACGACGGAG
GTGAGCTCATCTGTTGTGACGGCTGTCCCCGGGCCTTCCACCTGGCTTGCCTGTCCCCACCTCTGCAGGA
GATCCCCAGTGGCCTCTGGAGATGCTCCTGCTGCCTCCAGGGCAGAGTCCAACAGAACCTGTCCCAGCCT
GAGGTGTCCAGGCCCCCGGAGCTACCTGCAGAGACCCCGGACCAATCTCCGCTGCAAATCCTGCTCTGCA
GACTCGACTCCCACGCCAGGCACACCGGGCGAAGCTGTACCCACCTCTGGGCCCCGTCCAGCACCTGGGC
TTGCCAAGGTAGGGGACGACTCTGCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001271558
Insert Size 1218 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271558.1, NP_001258487.1
RefSeq Size 1682 bp
RefSeq ORF 1218 bp
Locus ID 11634
UniProt ID Q9Z0E3
Gene Summary Transcription factor playing an essential role to promote self-tolerance in the thymus by regulating the expression of a wide array of self-antigens that have the commonality of being tissue-restricted in their expression pattern in the periphery, called tissue restricted antigens (TRA) (Probable). Binds to G-doublets in an A/T-rich environment; the preferred motif is a tandem repeat of 5'-. ATTGGTTA-3' combined with a 5'-TTATTA-3' box. Binds to nucleosomes (By similarity). Binds to chromatin and interacts selectively with histone H3 that is not methylated at 'Lys-4', not phosphorylated at 'Thr-3' and not methylated at 'Arg-2'. Functions as a sensor of histone H3 modifications that are important for the epigenetic regulation of gene expression. Mainly expressed by medullary thymic epithelial cells (mTECs), induces the expression of thousands of tissue-restricted proteins, which are presented on major histocompatibility complex class I (MHC-I) and MHC-II molecules to developing T-cells percolating through the thymic medulla (By similarity). Also induces self-tolerance through other mechanisms such as the regulation of the mTEC differentiation program (PubMed:19015306). Controls the medullary accumulation of thymic dendritic cells and the development of regulatory T-cell through the regulation of XCL1 expression (PubMed:21300913). Regulates the production of CCR4 and CCR7 ligands in medullary thymic epithelial cells and alters the coordinated maturation and migration of thymocytes (PubMed:19923453). In thimic B-cells, allows the presentation of licensing-dependent endogenous self-anitgen for negative selection (PubMed:26070482). In secondary lymphoid organs, induces functional inactivation of CD4(+) T-cells. Expressed by a distinct bone marrow-derived population, induces self-tolerance through a mechanism that does not require regulatory T-cells and is resitant to innate inflammatory stimuli (PubMed:23993652).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (11) uses an alternate in-frame donor splice site and lacks two alternate exons in the coding region, which results in a translational frameshift, compared to variant 1. PubMed ID 10550218 supports this variant and calls it Aire 3c. The resulting protein (isoform 11) has a distinct C-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...