Palb2 (NM_001289845) Mouse Untagged Clone

CAT#: MC227425

Palb2 (untagged) - Mouse partner and localizer of BRCA2 (Palb2), transcript variant 5



  "NM_001289845" in other vectors (1)

CNY 3,710.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms BC066140
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227425 representing NM_001289845
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAGAGCTTTCCGGGAAGCCCCTCAGCTATGCGGAGAAGGAAAAGTTGAAGGAAAAGCTAGCATTTT
TGAAAAAGGAATACAGCAGGACACTTGCTCGACTTCAGACTGAAACTGCAGATCGCCCTGCTTGTGACAA
TCTAAACCCAGGAAACCTACAGTTGGTTTCAGAGTTAAAGAATCCTTCCAGTTCCTGCTCTGTGGATGTG
AGCGCCATGTGGTGGGAAAGAGCTGGTGCTAAGGAGCCATGTATCGTAACTGCTTGTGAAGATGTAGTTT
CTCTTTGGAAACCCTTGAATTCTCTGCAGTGGGAGAAAGTTCATACCTGGCACTTCACAGAGGTTCCAGT
ATTACAAATAGTTCCAGTGCCTGATGTTTACAATCTTATATGTGTAGCTTTGGGAAGTTTGGAAATCAGA
GAAATCAGGGCGTTGCTGTGCTCTTCTGGTGATGACAGTGAAAAGCAAGTCCTCCTGAAATCTGGAGATA
TAAAAGCTATGCTTGGCCTGACAAAGCGGAGGCTAGTTAGTAGCACTGGGACCTTTTGCAATCAACAAAT
ACAAATCATGACATTTGCTGACGACGGAAGCAGCAAAGATGAACAGCTTTTGATGCCTCCTGATGAGACT
GTACTGACTTTTGCTGAAGTCCAAGGGACGCAGGAAGCTCTGCTTGGTACTACCACTGTGAACAGCATTG
TGATCTGGAATTTAAAAACCGGCCAGCTCCTGAAGAAGATGCACATTGATGACTCCTACCAGGCTTCGGT
CTGTCACGGAGCCTATTCTGAGAAGGGGCTCCTGTTTGTTGTTGTGAGTCAACCTTGTGCCAAAGAGAGC
CAGGCCCTTGGAAGCCCTGTGTTCCAGCTGCTGGTGATTAACCCTAAGACGGCCCAGAGTGTGGGTGTTC
TGCTGTGTTCCCTTCCTCAGGGGCAGGCTGGAAGGTTCCTGGAAGGGGATGTGAAAGATCATGTCGCAGC
AGCAGTCCTGACTTCTGGGACAATTGCCATTTGGGATTTGCTTCTGGGTCACTGCACGGCTCTCCTCCCA
CCTGTCTCTGACCAGAGTTGGTCTTTGGTTAAATGGTCGGGTACAGATTCTCACTTGCTAGCTGGACAAA
AGGATGGAAATATATTTATATACCGATACTTTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289845
Insert Size 1155 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289845.1, NP_001276774.1
RefSeq Size 1590 bp
RefSeq ORF 1155 bp
Locus ID 233826
UniProt ID Q3U0P1
Gene Summary Plays a critical role in homologous recombination repair (HRR) through its ability to recruit BRCA2 and RAD51 to DNA breaks. Strongly stimulates the DNA strand-invasion activity of RAD51, stabilizes the nucleoprotein filament against a disruptive BRC3-BRC4 polypeptide and helps RAD51 to overcome the suppressive effect of replication protein A (RPA). Functionally cooperates with RAD51AP1 in promoting of D-loop formation by RAD51. Serves as the molecular scaffold in the formation of the BRCA1-PALB2-BRCA2 complex which is essential for homologous recombination. Via its WD repeats is proposed to scaffold a HR complex containing RAD51C and BRCA2 which is thought to play a role in HR-mediated DNA repair. Essential partner of BRCA2 that promotes the localization and stability of BRCA2. Also enables its recombinational repair and checkpoint functions of BRCA2. May act by promoting stable association of BRCA2 with nuclear structures, allowing BRCA2 to escape the effects of proteasome-mediated degradation. Binds DNA with high affinity for D loop, which comprises single-stranded, double-stranded and branched DNA structures. May play a role in the extension step after strand invasion at replication-dependent DNA double-strand breaks; together with BRCA2 is involved in both POLH localization at collapsed replication forks and DNA polymerization activity (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) lacks three consecutive exons in the coding region, compared to variant 1. It encodes isoform 5, which lacks an internal in-frame segment and is shorter, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...