Mdm4 (NM_001302804) Mouse Untagged Clone

CAT#: MC227284

Mdm4 (untagged) - Mouse transformed mouse 3T3 cell double minute 4 (Mdm4), transcript variant 5



  "NM_001302804" in other vectors (1)

CNY 3,520.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 4933417N07Rik; AA414968; AL023055; AU018793; AU021806; C85810; Mdmx
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227284 representing NM_001302804
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATTTTCCAAGTCAAGACCGACTGAAGCACGGTGCAACAGAATACTCCAATCCCAGAAAAAGAACTG
AAGAAGAGGATACTCACACACTGCCTACCTCACGACATAAATGCAGAGACTCCAGAGCAGATGAAGACTT
GATAGAACATTTATCTCAAGATGAGACATCTAGGCTTGACCTTGATTTTGAGGAGTGGGACGTTGCTGGC
CTGCCTTGGTGGTTTCTAGGGAATTTGAGAAACAACTGTATTCCTAAAAGTAATGGCTCAACTGATTTAC
AGACAAATCAGGATATAGGTACTGCCATTGTTTCAGACACTACGGATGATTTGTGGTTTTTAAATGAGAC
CGTGTCAGAGCAATTAGGTGTTGGAATAAAAGTTGAAGCTGCTAATTCTGAGCAAACAAGTGAAGTAGGG
AAAACAAGTAACAAGAAGACGGTGGAGGTGGGAAAGGATGATGATCTTGAGGACTCCAGGTCCTTGAGCG
ATGATACTGACGTGGAACTTACCTCTGAGGATGAGTGGCAGTGTACGGAATGCAAGAAGTTTAATTCTCC
AAGCAAGAGGTACTGTTTTCGTTGCTGGGCCTTGAGAAAGGATTGGTATTCGGATTGTTCTAAATTAACT
CATTCCCTATCTACATCTAATATTACTGCCATACCTGAAAAGAAGGACAATGAAGGAATTGATGTTCCCG
ATTGTAGGAGAACCATTTCAGCTCCTGTTGTTAGGCCTAAAGATGGATATTTAAAGGAGGAAAAGCCCAG
GTTTGACCCTTGCAACTCAGTGGGATTTTTGGATTTGGCTCATAGTTCTGAAAGCCAGGAGATCATCTCA
AGCGCGAGAGAACAAACAGATATTTTTTCTGAGCAGAAAGCTGAAACAGAAAGTATGGAAGATTTCCAGA
ATGTCTTGAAGCCGTGTAGCTTATGTGAAAAAAGGCCTCGGGATGGGAACATTATTCATGGGAAGACGAG
CCATCTGACGACATGTTTCCACTGTGCCAGGAGACTGAAGAAGTCTGGGGCTTCGTGTCCTGCTTGTAAG
AAAGAGATTCAGTTGGTTATTAAAGTTTTTATAGCATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001302804
Insert Size 1089 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001302804.1, NP_001289733.1
RefSeq Size 7194 bp
RefSeq ORF 1089 bp
Locus ID 17248
UniProt ID O35618
Gene Summary This gene encodes a protein that has been shown to negatively regulate the activity of the tumor suppressor protein p53. Homozygous knockout mice exhibit embryonic lethality as a result of p53-dependent apoptosis and cell cycle arrest. Amplification of this gene or overexpression of the encoded protein has been linked to a range of human cancers. A pseudogene has been identified on the X chromosome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (5) uses an alternate splice site in an internal exon, compared to variant 1. This variant represents translation initiation at a downstream AUG compared to variant 1; the 5'-most initiation codon, as used in variant 1, is associated with a truncated ORF that would render the transcript a candidate for nonsense-mediated decay (NMD). Leaky scanning may allow translation initiation at the downstream AUG to encode an isoform (3) that has a shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...