Gfra2 (NM_001302094) Mouse Untagged Clone

CAT#: MC227268

Gfra2 (untagged) - Mouse glial cell line derived neurotrophic factor family receptor alpha 2 (Gfra2), transcript variant 2



  "NM_001302094" in other vectors (1)

CNY 3,420.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227268 representing NM_001302094
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATCTTGGCAAACGCCTTCTGCCTCTTCTTCTTTTTAGGTGAGGAGTTCTACGAAGCTTCGCCCTATG
AGCCTGTGACCTCCCGCCTCTCGGACATCTTCAGGCTCGCTTCAATCTTCTCAGGGACAGGGGCAGACCC
GGTGGTCAGTGCCAAGAGCAACCACTGCCTGGATGCCGCCAAGGCCTGCAACCTGAACGACAACTGCAAG
AAGCTCCGCTCCTCCTACATCTCCATCTGCAACCGCGAGATCTCTCCCACCGAACGCTGCAACCGCCGCA
AGTGCCACAAGGCCCTGCGCCAGTTCTTCGACCGTGTGCCCAGCGAGTATACCTACCGCATGCTCTTCTG
CTCCTGTCAGGACCAGGCATGCGCCGAGCGTCGCCGGCAAACCATCCTGCCCAGCTGTTCCTATGAGGAC
AAAGAGAAGCCCAATTGCTTGGACCTGCGCAGCCTGTGTCGTACAGACCACTTGTGCCGGTCCCGCCTGG
CAGACTTCCACGCCAACTGTCGAGCCTCCTACCGGACAATCACCAGCTGCCCTGCGGACAACTACCAGGC
ATGTCTGGGCTCCTATGCTGGCATGATTGGGTTTGATATGACACCGAACTATGTGGACTCCAACCCCACG
GGCATCGTGGTGTCTCCCTGGTGCAATTGTCGTGGCAGTGGGAACATGGAAGAAGAGTGTGAGAAGTTCC
TCAAGGACTTCACAGAAAACCCATGCCTCCGGAATGCCATTCAAGCCTTTGGCAATGGCACAGATGTGAA
CATGTCTCCCAAAGGCCCCACATTTTCAGCTACCCAGGCCCCTCGGGTAGAGAAAACTCCTTCACTGCCA
GATGACCTCAGTGATAGCACCAGCCTGGGGACCAGTGTCATCACCACCTGCACATCTATCCAGGAGCAAG
GGCTGAAGGCCAACAACTCCAAAGAGTTAAGCATGTGTTTCACAGAGCTCACGACAAATATCAGCCCAGG
GAGTAAAAAGGTGATCAAACTTTACTCAGGCTCCTGCAGAGCCAGACTGTCGACTGCCTTGACTGCCCTC
CCACTCCTGATGGTGACCTTGGCCCAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001302094
Insert Size 1080 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001302094.1, NP_001289023.1
RefSeq Size 3172 bp
RefSeq ORF 1080 bp
Locus ID 14586
UniProt ID O08842
Gene Summary The protein encoded by this gene is part of the receptor complex that transduces glial cell-derived neurotrophic factor and neurturin signals by mediating autophosphorylation and activation of the RET receptor. Mice lacking this protein are viable and fertile but display growth retardation attributed to impaired salivary and pancreatic secretion and innervation deficits in the intestinal tract. In addition, knockout mice display neural defects including a failure to initiate outgrowth of dorsal ganglion root neurons, demonstrating a requirement in neuronal differentiation of these cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Transcript Variant: This variant (2) lacks an in-frame exon in the 5' coding region. This results in a shorter protein (isoform 2) compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...