Homer1 (NM_001284189) Mouse Untagged Clone

CAT#: MC227237

Homer1 (untagged) - Mouse homer homolog 1 (Drosophila) (Homer1), transcript variant c



  "NM_001284189" in other vectors (1)

CNY 3,420.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms homer-1; PSD-Zip45; SYN47; Ves-1; vesl-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227237 representing NM_001284189
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGGAGCAACCTATCTTCAGCACTCGAGCTCATGTCTTCCAGATTGACCCGAACACAAAGAAGAACT
GGGTACCCACCAGCAAGCATGCAGTTACTGTATCTTATTTTTATGACAGCACAAGAAATGTGTATAGGAT
AATCAGTTTAGATGGCTCAAAGGCAATAATAAATAGCACCATCACACCAAACATGACATTTACTAAAACA
TCTCAAAAGTTTGGCCAATGGGCTGATAGCCGGGCAAACACTGTTTATGGACTGGGATTCTCCTCTGAGC
ATCATCTTTCAAAATTCGCAGAAAAGTTTCAGGAATTTAAGGAAGCTGCTCGGCTTGCAAAGGAGAAGTC
GCAGGAGAAGATGGAGCTGACCAGTACCCCTTCACAGGAATCAGCAGGAGGAGATCTTCAGTCTCCTTTG
ACACCAGAAAGTATCAATGGGACAGACGATGAGAGAACACCCGATGTGACACAGAACTCAGAGCCAAGGG
CTGAGCCAACTCAGAATGCATTGCCATTTCCACATAGTTCAGCAATCAGCAAACACTGGGAGGCTGAGCT
AGCTACCCTCAAAGGCAACAATGCCAAACTCACTGCAGCCCTGCTGGAGTCCACTGCCAATGTGAAGCAG
TGGAAGCAACAGCTTGCTGCGTACCAGGAGGAAGCAGAGCGGCTGCACAAGCGGGTCACTGAGCTGGAGT
GTGTTAGTAGTCAAGCAAACGCTGTGCACAGCCACAAGACAGAGCTGAACCAGACAGTGCAGGAACTGGA
AGAGACCCTGAAAGTAAAGGAAGAGGAAATAGAAAGATTAAAACAAGAAATCGATAATGCCAGAGAACTC
CAAGAACAGAGGGACTCTTTGACTCAGAAACTACAGGAAGTTGAAATTCGAAATAAAGACCTGGAGGGGC
AGCTGTCTGACCTAGAACAGCGCCTGGAGAAGAGCCAGAACGAACAAGAGGCTTTCCGCAGTAACCTGAA
GACACTCCTAGAAATTCTGGATGGAAAAATATTTGAACTAACAGAATTACGAGATAATTTGGCCAAGCTA
CTGGAATGCAGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001284189
Insert Size 1065 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001284189.1, NP_001271118.1
RefSeq Size 4768 bp
RefSeq ORF 1065 bp
Locus ID 26556
UniProt ID Q9Z2Y3
Gene Summary Postsynaptic density scaffolding protein. Binds and cross-links cytoplasmic regions of GRM1, GRM5, ITPR1, DNM3, RYR1, RYR2, SHANK1 and SHANK3. By physically linking GRM1 and GRM5 with ER-associated ITPR1 receptors, it aids the coupling of surface receptors to intracellular calcium release. May also couple GRM1 to PI3 kinase through its interaction with AGAP2. Isoform 1 regulates the trafficking and surface expression of GRM5. Differentially regulates the functions of the calcium activated channel ryanodine receptors RYR1 and RYR2. Isoform 1 decreases the activity of RYR2, and increases the activity of RYR1, whereas isoform 5 counteracts the effects by competing for binding sites. Isoform 3 regulates the trafficking and surface expression of GRM5. Isoform 5 acts as a natural dominant negative, in dynamic competition with constitutively expressed isoform 1, isoform 2 and isoform 3 to regulate synaptic metabotropic glutamate function. Isoform 5, may be involved in the structural changes that occur at synapses during long-lasting neuronal plasticity and development (By similarity). Forms a high-order complex with SHANK1, which in turn is necessary for the structural and functional integrity of dendritic spines (By similarity). Negatively regulates T cell activation by inhibiting the calcineurin-NFAT pathway. Acts by competing with calcineurin/PPP3CA for NFAT protein binding, hence preventing NFAT activation by PPP3CA (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (b, also known as homer-1b) lacks an alternate in-frame exon in the central coding region, compared to variant L. The encoded isoform (b) is shorter than isoform L. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...