Mef2a (NM_001291196) Mouse Untagged Clone

CAT#: MC227222

Mef2a (untagged) - Mouse myocyte enhancer factor 2A (Mef2a), transcript variant 5



  "NM_001291196" in other vectors (1)

CNY 3,420.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
MEF2A Antibody - N-terminal region
    • 50 ug

CNY 4,381.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms A430079H05Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227222 representing NM_001291196
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTGTCACAGTCCCTGTGACCAGCCCTAATGCTTTGTCGTACACTAACCCAGGGAGTTCACTCGTGT
CACCGTCTTTGGCAGCCAGCTCAACATTAGCAGATTCGAGCATGCTGTCTCCACCCCCAGCCACGCTACA
TAGAAATGTGTCCCCAGGAGCTCCGCAGAGACCACCAAGTACCGGCAGTGCAAGTGGGATGTTGAGCACT
ACAGACCTCACGGTGCCAAATGGAGCTGGAAATAGTCCTGTGGGGAATGGATTTGTAAACTCAAGGGCCT
CTCCAAATTTGATTGGAAATACTGGTGCAAATAGTTTAGGCAAAGTCATGCCTACAAAGTCTCCCCCGCC
ACCAGGTGGTGGCAGTCTTGGAATGAACAGTCGGAAACCAGATCTACGAGTTGTCATTCCCCCATCAAGC
AAGGGCATGATGCCCCCACTTAATGCCCAAAGGATAAGCAGTTCTCAAGCCACTCAACCTCTTGCCACGC
CTGTAGTGTCTGTGACAACTCCGAGCTTGCCTCCACAGGGACTAGTGTACTCAGCAATGCCGACAGCCTA
CAACACTGATTACTCACTGACCAGCGCTGACCTGTCTGCCCTGCAAGGCTTTACTTCCCCTGGAATGCTG
TCTCTGGGGCAGGCTTCAGCCTGGCAGCAGCACCATCTAGGACAAGCAGCCCTCAGCTCTCTGGTGGCTG
GAGGGCAGTTATCTCAGGGTTCAAATTTGTCCATTAACACCAACCAGAACATCAACATTAAGTCAGAGCC
AATTTCACCTCCCCGTGATAGAATGACCCCATCAGGCTTCCAACAGCAGCAGCAGCAGCCACAACAGCAG
CCACCGCCACAACCTCCACAGCCCCAACCCCGGCAGGAAATGGGGCGCTCCCCTGTGGACAGTCTGAGCA
GCTCCAGCAGCTCCTATGATGGCAGTGACCGGGAGGATCCACGGGGTGACTTCCATTCTCCAATTGTGCT
TGGCCGACCTCCAAATACTGAGGACAGAGAAAGCCCTTCTGTAAAACGCATGAGGATGGACACATGGGTG
ACCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001291196
Insert Size 1056 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001291196.1, NP_001278125.1
RefSeq Size 5675 bp
RefSeq ORF 1056 bp
Locus ID 17258
UniProt ID Q60929
Gene Summary Transcriptional activator which binds specifically to the MEF2 element, 5'-YTA[AT](4)TAR-3', found in numerous muscle-specific genes. Also involved in the activation of numerous growth factor- and stress-induced genes. Mediates cellular functions not only in skeletal and cardiac muscle development, but also in neuronal differentiation and survival. Plays diverse roles in the control of cell growth, survival and apoptosis via p38 MAPK signaling in muscle-specific and/or growth factor-related transcription. In cerebellar granule neurons, phosphorylated and sumoylated MEF2A represses transcription of NUR77 promoting synaptic differentiation. Associates with chromatin to the ZNF16 promoter (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) contains an alternate exon, lacks an alternate in-frame exon, and initiates translation at an alternate start codon compared to variant 1. The resulting isoform (d) is shorter at the N-terminus and lacks an internal segment compared to variant 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...