Mapt (NM_001285456) Mouse Untagged Clone

CAT#: MC227141

Mapt (untagged) - Mouse microtubule-associated protein tau (Mapt), transcript variant 5



  "NM_001285456" in other vectors (1)

CNY 3,330.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI413597; AW045860; Mtapt; Tau
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227141 representing NM_001285456
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGACCCTCGCCAGGAGTTTGACACAATGGAAGACCATGCTGGAGATTACACTCTGCTCCAAGACC
AAGAAGGAGACATGGACCATGGCTTAAAAGCCGAAGAAGCAGGCATCGGAGACACCCCGAACCAGGAGGA
CCAAGCCGCTGGGCATGTGACTCAAGCTCGTGTGGCCAGCAAAGACAGGACAGGAAATGACGAGAAGAAA
GCCAAGGGCGCTGATGGCAAAACCGGGGCGAAGATCGCCACACCTCGGGGAGCAGCCTCTCCGGCCCAGA
AGGGCACGTCCAACGCCACCAGGATCCCGGCCAAGACCACGCCCAGCCCTAAGACTCCTCCAGGGTCAGG
TGAACCACCAAAATCCGGAGAACGAAGCGGCTACAGCAGCCCCGGCTCTCCCGGAACGCCTGGCAGTCGC
TCGCGCACCCCATCCCTACCAACACCGCCCACCCGGGAGCCCAAGAAGGTGGCAGTGGTCCGCACTCCCC
CTAAGTCACCATCAGCTAGTAAGAGCCGCCTGCAGACTGCCCCTGTGCCCATGCCAGACCTAAAGAATGT
CAGGTCGAAGATTGGCTCTACTGAGAACCTGAAGCACCAGCCAGGAGGTGGCAAGGTGCAAATAGTCTAC
AAGCCGGTGGACCTGAGCAAAGTGACCTCCAAGTGTGGCTCGTTAGGGAACATCCATCACAAGCCAGGAG
GTGGCCAGGTGGAAGTAAAATCAGAGAAGCTGGACTTCAAGGACAGAGTCCAGTCGAAGATTGGCTCCTT
GGATAATATCACCCACGTCCCTGGAGGAGGGAATAAGAAGATTGAAACCCACAAGCTGACCTTCAGGGAG
AATGCCAAAGCCAAGACAGACCATGGAGCAGAAATTGTGTATAAGTCACCCGTGGTGTCTGGGGACACAT
CTCCACGGCACCTCAGCAATGTGTCTTCCACGGGCAGCATCGACATGGTGGACTCACCACAGCTTGCCAC
ACTAGCCGATGAAGTGTCTGCTTCCTTGGCCAAGCAGGGTTTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001285456
Insert Size 1026 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001285456.1, NP_001272385.1
RefSeq Size 5129 bp
RefSeq ORF 1026 bp
Locus ID 17762
UniProt ID P10637
Gene Summary Promotes microtubule assembly and stability, and might be involved in the establishment and maintenance of neuronal polarity. The C-terminus binds axonal microtubules while the N-terminus binds neural plasma membrane components, suggesting that tau functions as a linker protein between both. Axonal polarity is predetermined by tau localization (in the neuronal cell) in the domain of the cell body defined by the centrosome. The short isoforms allow plasticity of the cytoskeleton whereas the longer isoforms may preferentially play a role in its stabilization.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) lacks two consecutive exons in the 5' coding region and an exon in the 3' coding region, compared to variant 1. The resulting isoform (e) lacks two internal segments, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...