Syne4 (NM_001290565) Mouse Untagged Clone

CAT#: MC226925

Syne4 (untagged) - Mouse spectrin repeat containing, nuclear envelope family member 4 (Syne4), transcript variant 2



  "NM_001290565" in other vectors (1)

CNY 3,040.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 0610012K07Rik; AI428936; KASH4; Nesp4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226925 representing NM_001290565
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCCTGGTTCCACCTCTTGGCCGTGAATTCCCGCCAGAGCCTGTGAATTGTCCCCTGGCAGCTCCTA
GAGAGCTGGATGTTGTCGGAGGGACCATCTGCCCTGCACCTGAGGAAGAGACAAGCAGGCCAGAGCAGGT
CCAGGCCTCCTTGGGCCTGCCTGAGCATTGCATGGGTGAACTGAAGAGCACTGAGTCTGCCACCAGCCCC
TCAAGACTCCCCCTGGCCTCTTCCCATGAGCATCAAGACGGGGGCAAGCCCTGTGAGCACTCTGACTCTG
GTTTGGAAGTACTAGAAGCTGAACAGGACAGTCTACATCTTTGTCTGTTGAGGTTGAACTTCCGGCTGCA
GGACCTGGAACGAGGCCTTGGGTCTTGGACGCTGGCCCACAACAGGATTGTCCAGATGCAGGCCCTGCAG
GCAGAGCTACGAGGGGCCGCTGAGCGCGTGGATGCATTGCTTGCATTTGGTGAGGGCCTGGCAGAGAGGA
GTGAGCCCAGGGCCTGGGCATCCCTGGAGCAGGTCCTGAGGGCCCTTGGAACCCACCGAGACACCATCTT
CCAACGGCTCTGGCAGCTGCAGGCCCAGTTGATCAGCTATAGCCTGGACCTGCTCTCCTTGGGGCTTGGC
CACCGGAAACATTTAGCGGCTCACCATCGAAGGCGGCTCCGGAAGCCTCAGGACAGGAAGAGGCAAGTAT
CCCCCAGTCTGCCTGATGCAATGCTGGAAGTGGATCGCGGGGTCCCAGCTCCTGCATCCAAGCGGCCCCT
GACCCTCTTCTTTCTCCTTCTCTTCCTCCTTCTGGTGGGTGCCACGCTGTTGCTGCCCTTGTCGGGGGTC
TCCTGCTGTTCTCATGCCCGGCTGGCTAGGACGCCCTACCTGGTGCTCAGTTATGTCAATGGTCTCCCTC
CAATCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001290565
Insert Size 918 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001290565.1, NP_001277494.1
RefSeq Size 1105 bp
RefSeq ORF 918 bp
Locus ID 233066
Gene Summary As a component of the LINC (LInker of Nucleoskeleton and Cytoskeleton) complex, involved in the connection between the nuclear lamina and the cytoskeleton. The nucleocytoplasmic interactions established by the LINC complex play an important role in the transmission of mechanical forces across the nuclear envelope and in nuclear movement and positioning (By similarity). Behaves as a kinesin cargo, providing a functional binding site for kinesin-1 at the nuclear envelope. Hence may contribute to the establishment of secretory epithelial morphology, by promoting kinesin-dependent apical migration of the centrosome and Golgi apparatus and basal localization of the nucleus.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...