Ispd (NM_001289504) Mouse Untagged Clone

CAT#: MC226798

Ispd (untagged) - Mouse isoprenoid synthase domain containing (Ispd), transcript variant 4



  "NM_001289504" in other vectors (1)

CNY 2,850.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
ISPD Antibody - middle region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 4930579E17Rik; AV040780
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226798 representing NM_001289504
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGCCTGGGCCGTGCAGCAGGCCCGCTGAGCCTGGGCATTGCGTGAGCGGCCCCGCGGGCGCGGGCT
CAGCGTTCCCGGAGTCCCCGTTGTCCGTCGCTGGGGCGGAGCCCGGGAACCGCCCTGGAACCGTGGCCGC
CGTGCTGCCGGCTGGGGGTTGCGGGGAAAGGATGGGCGTCCGCACCCCGAAGCAGTTCTGCCGGGTTCTG
GAAAGGCCGCTCATCAGCTACACTTTGCAGGCTATGGAGAGAGTATGCTGGATAAAGGACATTGTTGTGA
CAGTGACAGGGGAGAACATGGAAGCAATGAGAAGTATCATCCAGAGGTATGGGCATAAGCGCATCTCACT
AGCTGAGGCTGGAGCCACGCGCCACAGATCAATTTTCAATGGACTGAAAGCCCTGGCAGAAGATCAGCCA
GACTGTAAACTCACTAAGCCAGAAGTGGTGATTATCCATGACGCCGTGAGACCTTTTGTTGAGGAAGATA
TCCTCCTGAGAGTTGTCTTAGCAGCTAAGGAACATGGGGCAGCAGGAGCAATTCGACCTCTGGTGTCCAC
TGTCATCAGTCCCTCTGCTGATGGTCACTTAGACCACTCACTGGACCGTGCCAAGCATAGGGCAAGCGAA
ATGCCCCAGGCTTTTCTCTTTGATGTCATCTATGAAGCGTATCAGCAGTGTAGTGATTTTGACTTGGAAT
TTGGAACAGAGTGCTTGCAGTTGGCTCTAAAATACTGTCACAGGAAAGCAAAACTTGTAGAAGGGCCCCC
TGCCCTCTGGAAGGTGACCTACAAACAAGACCTGTGTGCAGCTGAAGCCATGATTAAAGGTGTGTTCAAC
CTTGTGACTGTCAGCGCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289504
Insert Size 861 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289504.1, NP_001276433.1
RefSeq Size 3246 bp
RefSeq ORF 861 bp
Locus ID 75847
UniProt ID Q5RJG7
Gene Summary Cytidylyltransferase required for protein O-linked mannosylation (By similarity). Catalyzes the formation of CDP-ribitol nucleotide sugar from D-ribitol 5-phosphate (By similarity). CDP-ribitol is a substrate of FKTN during the biosynthesis of the phosphorylated O-mannosyl trisaccharide (N-acetylgalactosamine-beta-3-N-acetylglucosamine-beta-4-(phosphate-6-)mannose), a carbohydrate structure present in alpha-dystroglycan (DAG1), which is required for binding laminin G-like domain-containing extracellular proteins with high affinity (By similarity). Shows activity toward other pentose phosphate sugars and mediates formation of CDP-ribulose or CDP-ribose using CTP and ribulose-5-phosphate or ribose-5-phosphate, respectively (By similarity). Not Involved in dolichol production (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) lacks several exons and its 3' terminal exon extends past a splice site that is used in variant 1. This results in a novel 3' coding region and 3' UTR, compared to variant 1. The encoded protein (isoform 4) is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...