Cebpb (NM_001287738) Mouse Untagged Clone

CAT#: MC226723

Cebpb (untagged) - Mouse CCAAT/enhancer binding protein (C/EBP), beta (Cebpb), transcript variant 1



  "NM_001287738" in other vectors (1)

CNY 2,760.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms C/EBPbeta; CRP2; IL-6DBP; LAP; LIP; NF-IL6; NF-M; Nfil6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226723 representing NM_001287738
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAGTGGCCAACTTCTACTACGAGCCCGACTGCCTGGCCTACGGGGCCAAGGCGGCCCGCGCCGCGC
CGCGCGCCCCCGCCGCCGAGCCGGCCATTGGCGAGCACGAGCGCGCCATCGACTTCAGCCCCTACCTGGA
GCCGCTCGCGCCCGCCGCGGACTTCGCCGCGCCCGCGCCCGCGCACCACGACTTCCTCTCCGACCTCTTC
GCCGACGACTACGGCGCCAAGCCGAGCAAGAAGCCGGCCGACTACGGTTACGTGAGCCTCGGCCGCGCGG
GCGCCAAGGCCGCGCCGCCCGCCTGCTTCCCGCCGCCGCCTCCCGCCGCGCTCAAGGCGGAGCCGGGCTT
CGAACCCGCGGACTGCAAGCGCGCGGACGACGCGCCCGCCATGGCGGCCGGTTTCCCGTTCGCCCTGCGC
GCCTACCTGGGCTACCAGGCGACGCCGAGCGGCAGCAGCGGCAGCCTGTCCACGTCGTCGTCGTCCAGCC
CGCCCGGCACGCCGAGCCCCGCCGACGCCAAGGCCGCGCCCGCCGCCTGCTTCGCGGGGCCGCCGGCCGC
GCCCGCCAAGGCCAAGGCCAAGAAGACGGTGGACAAGCTGAGCGACGAGTACAAGATGCGGCGCGAGCGC
AACAACATCGCGGTGCGCAAGAGCCGCGACAAGGCCAAGATGCGCAACCTGGAGACGCAGCACAAGGTGC
TGGAGCTGACGGCGGAGAACGAGCGGCTGCAGAAGAAGGTGGAGCAGCTGTCGCGAGAGCTCAGCACCCT
GCGGAACTTGTTCAAGCAGCTGCCCGAGCCGCTGCTGGCCTCGGCGGGCCACTGCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001287738
Insert Size 828 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001287738.1, NP_001274667.1
RefSeq Size 1518 bp
RefSeq ORF 828 bp
Locus ID 12608
UniProt ID P28033
Gene Summary Important transcription factor regulating the expression of genes involved in immune and inflammatory responses (PubMed:16585579, PubMed:17911624, PubMed:18486321, PubMed:20111005). Plays also a significant role in adipogenesis, as well as in the gluconeogenic pathway, liver regeneration, and hematopoiesis (PubMed:9727068, PubMed:10635333, PubMed:17301242, PubMed:17601773, PubMed:19478079, PubMed:24061474, PubMed:24216764). The consensus recognition site is 5'-T[TG]NNGNAA[TG]-3'. Its functional capacity is governed by protein interactions and post-translational protein modifications. During early embryogenesis, plays essential and redundant functions with CEBPA (PubMed:15509779). Has a promitotic effect on many cell types such as hepatocytes and adipocytes but has an antiproliferative effect on T-cells by repressing MYC expression, facilitating differentiation along the T-helper 2 lineage (PubMed:9727068, PubMed:10635333, PubMed:16585579). Binds to regulatory regions of several acute-phase and cytokines genes and plays a role in the regulation of acute-phase reaction and inflammation. Plays also a role in intracellular bacteria killing (PubMed:17911624). During adipogenesis, is rapidly expressed and, after activation by phosphorylation, induces CEBPA and PPARG, which turn on the series of adipocyte genes that give rise to the adipocyte phenotype. The delayed transactivation of the CEBPA and PPARG genes by CEBPB appears necessary to allow mitotic clonal expansion and thereby progression of terminal differentiation (PubMed:15985551, PubMed:17301242, PubMed:17601773, PubMed:20194620). Essential for female reproduction because of a critical role in ovarian follicle development (PubMed:9303532). Restricts osteoclastogenesis (PubMed:19440205). Together with NFE2L1; represses expression of DSPP during odontoblast differentiation (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes multiple isoforms through the use of alternative translation initiation codons. The isoform (b, also known as LAP) represented in this RefSeq results from translation initiation at the second in-frame AUG start codon. Isoform b has a shorter N-terminus, compared to isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...