Dcun1d1 (NM_001205361) Mouse Untagged Clone

CAT#: MC226632

Dcun1d1 (untagged) - Mouse DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) (Dcun1d1), transcript variant 1



  "NM_001205361" in other vectors (1)

CNY 2,570.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms pTes3; Rp42; SCCRO; Tes3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226632 representing NM_001205361
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACAAGTTGAAATCATCGCAGAAGGATAAAGTTCGTCAGTTTATGATCTTCACACAATCTAGTGAGA
AAACTGCAGTAAGTTGTCTTTCTCAAAATGACTGGAAGTTAGATGTTGCAACAGATAATTTTTTTCAAAA
TCCAGAACTTTATATACGGGAGAGTGTAAAAGGATCGTTGGACAGGAAGAAGTTAGAGCAACTGTACACT
AGATACAAAGACCCTCAGGATGAAAATAAAATTGGAATAGATGGTATACAGCAGTTCTGTGATGATCTGG
CCCTCGATCCAGCCAGCATCAGTGTGTTGATCATTGCATGGAAGTTCAGGGCGGCCACACAGTGCGAGTT
CTCCAAACAGGAGTTCATGGATGGCATGACAGAGTTAGGATGTGACAGCATAGAAAAACTAAAGGCCCAA
ATACCCAAGATGGAACAAGAATTGAAAGAACCAGGACGATTTAAGGATTTTTACCAGTTTACTTTTAATT
TTGCAAAGAATCCAGGACAAAAAGGATTAGATCTAGAAATGGCCATTGCTTACTGGAACTTAGTGCTTAA
TGGAAGATTTAAATTCTTAGACTTATGGAATAAATTTTTGTTGGAGCATCATAAACGATCAATACCAAAA
GACACGTGGAATCTTCTGTTAGACTTCAGTTCAATGATTGCAGATGACATGTCCAATTATGATGAAGAAG
GAGCATGGCCTGTCCTTATTGATGACTTTGTGGAATTTGCACGCCCTCAAATTGCTGGGACAAAAAGTAC
AACAGTGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001205361
Insert Size 780 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001205361.1, NP_001192290.1
RefSeq Size 4474 bp
RefSeq ORF 780 bp
Locus ID 114893
UniProt ID Q9QZ73
Gene Summary Part of an E3 ubiquitin ligase complex for neddylation. Promotes neddylation of cullin components of E3 cullin-RING ubiquitin ligase complexes. Acts by binding to cullin-RBX1 complexes in the cytoplasm and promoting their nuclear translocation, enhancing recruitment of E2-NEDD8 (UBE2M-NEDD8) thioester to the complex, and optimizing the orientation of proteins in the complex to allow efficient transfer of NEDD8 from the E2 to the cullin substrates. Involved in the release of inhibitory effets of CAND1 on cullin-RING ligase E3 complex assembly and activity (By similarity). Acts also as an oncogene facilitating malignant transformation and carcinogenic in vivo (PubMed:20563250).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...